Arabidopsis small RNA Gene Analysis

The basic information for the gene you have selected is displayed below. The "small RNA Information" section sums the reads that map to either strand of the gene of interest, indicating the total (normalized) read abundance, the count of distinct (different) sequences, and providing links to a downloadable file with that information, and web pages that provide detailed information on the complete set of individual sequences derived from the gene. View a legend that explains the icons and colors in the image below. Adjust libraries/reads or change display options on the control panel. In the control panel, you can show a special "phasing analysis" for small RNAs in this region.



GTAGATACCATGATAAAAAGTAAAGAACGGAAAAGATGAAAATCACAAAACTATAGTTGGTAGTAGAGAGAGTATAGTGTTTGGGGGAACTCCCAAGTGTTTGGGGGAACTCCCGAAGTGTTTGGGGGAACTCGAAGTGTTTGGGGGAACTCCCTGAAGTGTTTGGGGGAACTGAAGTGTTTGGGGGAACTTGAAGTGTTTGGGGGAACTCTGAAGTGTTTGGGGGAACTCCCTGAAGTGTTTGGGGGAACTGAAGTGTTTGGGGGAACCTGAAGTGTTTGGGGGAACTCTGAAGTGTTTGGGGGAACTCCTGAAGTGTTTGGGGGAACTCCACTGAAGTGTTTGGGGGAACACTGAAGTGTTTGGGGGAACTACTGAAGTGTTTGGGGGAACTCCCACTGAAGTGTTTGGGGGAACTCCACTGAAGTGTTTGGGGGAACTCTTCAGGAGAACTCTAGAGGACAGTTCTCCTGAACACTTCATTGTTCTCCTGAACACTTCATTGGTTCTCCTGAACACTTCATTGGGTTCTCCTGAACACTTCATTGGAGTTCTCCTGAACACTTCATTGGAATAGAGTTCTCCTGAACACTTCTCTAGAGTTCTCCTGAACACTCTAGAGTTCTCCTGAACACTTCTAGAGTTCTCCTGAACACTTCAGCGAGAACTAAAGAATCTCClick to see list of reads
Gene map

Gene Chr Strand Gene Type 5' End 3' End Model # of Splice Variants
ath-MIR395d 1 c miRNA 26,270,078 26,269,979 1 No splice variant annotated
    Predicted function: miRNA