N. benthi small RNA Phasing Analysis Window: 21 nt reads (21 nt cycles)

This page highlights small RNAs "in phase" with the first selected position. Highlighted small RNAs correspond to the coordinates of each cycle (i.e. those that are in phase or register with the initial location), allowing a one nucleotide shift so that they may be -1/0/+1 nt relative to the start position, in increments corresponding to the phase length (i.e. for a 21-nt phase, acceptably phased small RNAs may be located 20, 21 or 22 nt away). Opposite-strand reads are shifted by (phasing length - 3) to allow for the 2-nt 3' overhang typical of a Dicer-mediated cleavage. In-phase reads are highlighted: exactly-in-phase positions appear in a darker shade, and almost-in-phase (-1/+1) positions in a lighter shade. The tables list all small RNAs whose lengths are from 18 to 26 nt, and these are shown in the upper of the two images boxes; the Phasing Analysis viewer (lower image box) shows only those phasing cycles corresponding to the featured length (the default length is 21 nt). You can adjust libraries, reads, or change display options (e.g. the phasing cycle length) on the control panel. Click the "Tabular View" to go to our Gene Analysis viewer for this region.



 Cycle #1Cycle #2Cycle #3Cycle #4Cycle #5Cycle #6Cycle #7Cycle #8Cycle #9Cycle #10
W strand:   98,403,593>>  98,403,614>>  98,403,635>>  98,403,656>>  98,403,677>>  98,403,698>>  98,403,719>>  98,403,740>>  98,403,761>>  98,403,782>> 
C  strand:   <<98,403,611  <<98,403,632  <<98,403,653  <<98,403,674  <<98,403,695  <<98,403,716  <<98,403,737  <<98,403,758  <<98,403,779  <<98,403,800 

Go to the viewer for this phasing analysis window (padded with 10 cycles downstream and 10 cycles upstream)

  


W Strand Reads

#SignatureHitsCoordinateStrandLen  25Bm_SatNben_Flr_aNben_Flr_bNben_Stem_aNben_Stem_bNben_Root_aNben_Root_bNben_Leaf_aNben_Leaf_bNben_Seedling_aNben_Seedling_bNBen_LeafBTI25Bm25Mock18Bm_Sat18Bm18Mockcym19s_icym19s_ipmock_imock_iprsv_i1rsv_ipcym19_1ipcym19_2ipcym19_irsv_1iprsv_2iprsv_agoim_1ipm_2ipm_icym19_dmock_dcym19_1ip2cym19_2ip2cym19_i2rsv_1ip2rsv_2ip2rsv_i2m_1ip2m_2ip2m_i2pvx_iHCPro_iHCPro_t2HCPromut_tNb_miR173Nb_LeavesNNTMV8hrNNTMV2hrNNTMV0hrNb_1VaNb_1VbNb_1UaNb_1UbNgfp10_1Ngfp5_1Npg6_1Npg8_2Npg_12_1
Signature abundances normalized to (varies by library depth):   10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M10M
1TCTGAACAATCACAACTGCAA298,403,594w21  0000100000000000000000000000000000000000000000000000000000000




C Strand Reads

There are no reads associated with this region.


CGATTGATGTCTGAACAATCTCTGAACAATCACAACTGCAAClick to see list of reads Featured window:  98,403,593 (w strand)98,403,594 - 98,403,803 Featured window:  98,403,593 (w strand)Click to see list of phasing windowsClick to see list of phasing windows
Gene map
Phasing analysis map
Phasing Analysis (above): Each dot represents a "window" of ten cycles of small RNAs of length 21 nt (where 21 is set in the control panel under Select phasing analysis options), with the score for the degree of phasing indicated on the Y axis (scores calculated approximately as described by Howell et al., 2007). The red dot is the highest scoring window and has the best score in this region. Other colored dots are windows which are in phase with the highest scoring window -- exactly-in-phase windows appear as filled dots, and almost-in-phase (-1/+1) windows as hollow dots. Only those reads corresponding to the featured length (the default length is 21 nt) are considered. In this version, each window appears on its original strand regardless the option selected for "Strand(s) to show phasing windows" in the control panel.