This page highlights small RNAs "in phase" with the first selected position. Highlighted small RNAs correspond to the coordinates of each cycle (i.e. those that are in phase or register with the initial location), allowing a one nucleotide shift so that they may be -1/0/+1 nt relative to the start position, in increments corresponding to the phase length (i.e. for a 21-nt phase, acceptably phased small RNAs may be located 20, 21 or 22 nt away). Opposite-strand reads are shifted by (phasing length - 3) to allow for the 2-nt 3' overhang typical of a Dicer-mediated cleavage. In-phase reads are highlighted: exactly-in-phase positions appear in a darker shade, and almost-in-phase (-1/+1) positions in a lighter shade. The tables list all small RNAs whose lengths are from 18 to 26 nt, and these are shown in the upper of the two images boxes; the Phasing Analysis viewer (lower image box) shows only those phasing cycles corresponding to the featured length (the default length is 21 nt). You can adjust libraries, reads, or change display options (e.g. the phasing cycle length) on the control panel. Click the "Tabular View" to go to our Gene Analysis viewer for this region.
| Cycle #10 | Cycle #9 | Cycle #8 | Cycle #7 | Cycle #6 | Cycle #5 | Cycle #4 | Cycle #3 | Cycle #2 | Cycle #1 | |
| W strand: | 98,404,239>> | 98,404,260>> | 98,404,281>> | 98,404,302>> | 98,404,323>> | 98,404,344>> | 98,404,365>> | 98,404,386>> | 98,404,407>> | 98,404,428>> |
| C strand: | <<98,404,257 | <<98,404,278 | <<98,404,299 | <<98,404,320 | <<98,404,341 | <<98,404,362 | <<98,404,383 | <<98,404,404 | <<98,404,425 | <<98,404,446 |
Go to the viewer for this phasing analysis window (padded with 10 cycles downstream and 10 cycles upstream)
| # | Signature | Hits | Coordinate | Strand | Len | 25Bm_Sat | Nben_Flr_a | Nben_Flr_b | Nben_Stem_a | Nben_Stem_b | Nben_Root_a | Nben_Root_b | Nben_Leaf_a | Nben_Leaf_b | Nben_Seedling_a | Nben_Seedling_b | NBen_LeafBTI | 25Bm | 25Mock | 18Bm_Sat | 18Bm | 18Mock | cym19s_i | cym19s_ip | mock_i | mock_ip | rsv_i1 | rsv_ip | cym19_1ip | cym19_2ip | cym19_i | rsv_1ip | rsv_2ip | rsv_agoi | m_1ip | m_2ip | m_i | cym19_d | mock_d | cym19_1ip2 | cym19_2ip2 | cym19_i2 | rsv_1ip2 | rsv_2ip2 | rsv_i2 | m_1ip2 | m_2ip2 | m_i2 | pvx_i | HCPro_i | HCPro_t2 | HCPromut_t | Nb_miR173 | Nb_Leaves | NNTMV8hr | NNTMV2hr | NNTMV0hr | Nb_1Va | Nb_1Vb | Nb_1Ua | Nb_1Ub | Ngfp10_1 | Ngfp5_1 | Npg6_1 | Npg8_2 | Npg_12_1 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Signature abundances normalized to (varies by library depth): | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | 10M | ||||||
| 1 | GCAGCCCGGAAAGGAAGAGCT | 1 | 98,404,447 | c | 21 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | |