Rice small RNA Information

New Search

Reads existing in this region (Chr 1, 23,923,874 - 23,924,274): 1 - 4 of 4

Page 1 of 1: 1

#	Sequence	Hits	Coordinate	Strand	Len	Separator	WT2003s	WT2007s	WT2011s	T2iZ11R	T2iZ11S	T4iZ11S	T4iZ11R	T6iZ11R	T6P9R	T6Sp1R	AGO18IP_RSV1	AGO18IP_RSV2	AGO1bIP_RSV2	AGO1aIP_RSV1	AGO1aIP_RSV2	AGO1bIP_RSV1	wt_kit_adult	miR2_adult	miR7b_adult	miR8_adult	miR390_KO1	miR390_KO2	wt390r1	wt390r2
Signature abundances normalized to (varies by library depth):						Separator	10M	10M	10M	10M	10M	10M	10M	10M	10M	10M	500K	500K	500K	500K	500K	500K	20M	20M	20M	20M	20M	20M	20M	20M
1	CGACGAGCGGAAGCTGAGGCT	1	23,923,888	w	21	Separator	0	3	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
2	CGACGAGCGGAAGCTGAGGCTGC	1	23,923,888	w	23	Separator	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0
3	GCGGATGATGAGGAGGAGGGGGT	1	23,923,973	c	23	Separator	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0
4	CGAGAATCGAAACGGATCGACGAC	1	23,924,034	c	24	Separator	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0

Number of unique reads retrieved on this page: 4