Rice small RNA Information

New Search

Reads existing in this region (Chr 1, 23,923,874 - 23,924,274): 1 - 2 of 2

Page 1 of 1: 1

#	Sequence	Hits	Coordinate	Strand	Len	Separator	RRF	RRG	RSF	RSG	NNA	NEA	KNA	KEA	OsEnd5d	OsEnd10d	cle1_5d	cle1_10d	RAs1I	RPAs1I	RSe1I	RSSe1I	ShAs1I	ShPAs1I	ShSe1I	ShSSe1I	PCDJI	Pr2I	RCm1D	RB1D	RFe1D	RZn1D	ShCm1D	ShB1D	ShFe1D	ShZn1D
Signature abundances normalized to (varies by library depth):						Separator	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M	2M
1	GCCGCCGCCGCCGCCGCTC	255	23,923,882	c	19	Separator	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
2	CGGTTGATCGAGGCGCTGAGAT	1	23,924,060	w	22	Separator	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0

Number of unique reads retrieved on this page: 1