| Annotated species | Arabidopsis thaliana | Annotation built on | TAIR 10 | Total number of genes | 33,845 |
|---|---|---|---|---|---|
| Library type | PARE | Total bp in genome | 119,667,750 | Protein coding | 29,942 |
| Total number of libraries | 18 | Total chrs or contigs | 7 | Transposon related | 3,903 |
| Annotated species | Arabidopsis thaliana | Annotation built on | TAIR 10 | Total number of genes | 33,845 |
|---|---|---|---|---|---|
| Library type | PARE | Total bp in genome | 119,667,750 | Protein coding | 29,942 |
| Total number of libraries | 18 | Total chrs or contigs | 7 | Transposon related | 3,903 |
The PARE data on this site comes from our own libraries, which were published in Cell Reports. Raw data were submitted to GEO under GSE169433.
Some data contributed by: Pascal Genschik (Institut de Biologie Moléculaire des Plantes - UPR2357 - CNRS).
| known microRNAs: | ath-miR167a ath-miR172b | |
| known microRNA targets: | At1g30490 At3g11440 At2g28350 | |
| trans-acting siRNAs | TAS1a TAS1b TAS1c TAS2 TAS3a TAS3b TAS3c TAS4 |
Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.
Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).
| Protein or gene ID
Bulk Query |
e.g. AT1G01010 |
| Cluster or coordinate ID
Bulk Query |
e.g. AT_TAIR10.1.2001.500 (cluster)
AT_TAIR10.1.2001.4500 (coordinate)
|
| Sequence of PARE read
Bulk Query |
e.g. AACCATTGAAATCGGACGGT
|
| Keyword for genes/proteins or repeats |
Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position. Note that if the genome has a mix of both chromosomes and small contigs or scaffolds, we only show images for the defined chromosomes, and contigs must be accessed via their ID.

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.