About This Database

FAQs

Annotated species Phyllostachys edulis Annotation built on National Center for Gene Research, Chinese Academy of Sciences 1.0 Total number of genes 31,987
Library type small RNA Total bp in genome 2,051,719,643 Protein coding 31,987
Total number of libraries 8 Total chrs or contigs 277,278 Transposon related 0

This website was set up to organize our work in a comparative analysis of monocot small RNAs, described in a paper on bioRxiv. Some of these data from bamboo were harvested from public sources including Genbank, as cited on our library information page. Additional data and databases are accessible and described on our index page.

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query

e.g. PH01000001G0110
Cluster or coordinate ID
Bulk Query

e.g. BAMBOO_moso_NCGR1.1.2001.500 (cluster)   BAMBOO_moso_NCGR1.1.2001.4500 (coordinate)
Sequence of small RNA read
Bulk Query
e.g. TTGGACTTACCTCGGAGGAAGGC
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.