About This Database    FAQs

Annotated species Hordeum vulgare Annotation built on GrainGenes v3 Total number of genes 39,088
Library type small RNA Total bp in genome 4,225,718,519 Protein coding 39,088
Total number of libraries 42 Total chrs or contigs 8 Transposon related 0
The number of genomic-matches per small RNA ("hits") has been capped in this database at the following maximum: 100   (?)

The barley small RNA data on this site comes from our own libraries, which were published in Plant Physiology.

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query

e.g. 1HG0000030
Cluster or coordinate ID
Bulk Query

e.g. BARLEY_Morexv3.1.2001.500 (cluster)   BARLEY_Morexv3.1.2001.4500 (coordinate)
Sequence of small RNA read
Bulk Query
e.g. CAAAATGTTCGGATGGCATCGGGA
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position. Note that if the genome has a mix of both chromosomes and small contigs or scaffolds, we only show images for the defined chromosomes, and contigs must be accessed via their ID.

0 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 150,000,000150,000,000 - 175,000,000175,000,000 - 200,000,000200,000,000 - 225,000,000225,000,000 - 250,000,000250,000,000 - 275,000,000275,000,000 - 300,000,000300,000,000 - 325,000,000325,000,000 - 350,000,000350,000,000 - 375,000,000375,000,000 - 400,000,000400,000,000 - 425,000,000425,000,000 - 450,000,000450,000,000 - 475,000,000475,000,000 - 500,000,000500,000,000 - 516,505,932516,505,932 - 516,505,932516,505,932 - 516,505,932516,505,932 - 516,505,932516,505,932 - 516,505,932516,505,932 - 516,505,932516,505,932 - 516,505,9320 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 150,000,000150,000,000 - 175,000,000175,000,000 - 200,000,000200,000,000 - 225,000,000225,000,000 - 250,000,000250,000,000 - 275,000,000275,000,000 - 300,000,000300,000,000 - 325,000,000325,000,000 - 350,000,000350,000,000 - 375,000,000375,000,000 - 400,000,000400,000,000 - 425,000,000425,000,000 - 450,000,000450,000,000 - 475,000,000475,000,000 - 500,000,000500,000,000 - 525,000,000525,000,000 - 550,000,000550,000,000 - 575,000,000575,000,000 - 600,000,000600,000,000 - 625,000,000625,000,000 - 650,000,000650,000,000 - 665,585,7310 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 150,000,000150,000,000 - 175,000,000175,000,000 - 200,000,000200,000,000 - 225,000,000225,000,000 - 250,000,000250,000,000 - 275,000,000275,000,000 - 300,000,000300,000,000 - 325,000,000325,000,000 - 350,000,000350,000,000 - 375,000,000375,000,000 - 400,000,000400,000,000 - 425,000,000425,000,000 - 450,000,000450,000,000 - 475,000,000475,000,000 - 500,000,000500,000,000 - 525,000,000525,000,000 - 550,000,000550,000,000 - 575,000,000575,000,000 - 600,000,000600,000,000 - 621,516,506621,516,506 - 621,516,506621,516,506 - 621,516,5060 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 150,000,000150,000,000 - 175,000,000175,000,000 - 200,000,000200,000,000 - 225,000,000225,000,000 - 250,000,000250,000,000 - 275,000,000275,000,000 - 300,000,000300,000,000 - 325,000,000325,000,000 - 350,000,000350,000,000 - 375,000,000375,000,000 - 400,000,000400,000,000 - 425,000,000425,000,000 - 450,000,000450,000,000 - 475,000,000475,000,000 - 500,000,000500,000,000 - 525,000,000525,000,000 - 550,000,000550,000,000 - 575,000,000575,000,000 - 600,000,000600,000,000 - 610,333,535610,333,535 - 610,333,535610,333,535 - 610,333,5350 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 150,000,000150,000,000 - 175,000,000175,000,000 - 200,000,000200,000,000 - 225,000,000225,000,000 - 250,000,000250,000,000 - 275,000,000275,000,000 - 300,000,000300,000,000 - 325,000,000325,000,000 - 350,000,000350,000,000 - 375,000,000375,000,000 - 400,000,000400,000,000 - 425,000,000425,000,000 - 450,000,000450,000,000 - 475,000,000475,000,000 - 500,000,000500,000,000 - 525,000,000525,000,000 - 550,000,000550,000,000 - 575,000,000575,000,000 - 588,218,686588,218,686 - 588,218,686588,218,686 - 588,218,686588,218,686 - 588,218,6860 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 150,000,000150,000,000 - 175,000,000175,000,000 - 200,000,000200,000,000 - 225,000,000225,000,000 - 250,000,000250,000,000 - 275,000,000275,000,000 - 300,000,000300,000,000 - 325,000,000325,000,000 - 350,000,000350,000,000 - 375,000,000375,000,000 - 400,000,000400,000,000 - 425,000,000425,000,000 - 450,000,000450,000,000 - 475,000,000475,000,000 - 500,000,000500,000,000 - 525,000,000525,000,000 - 550,000,000550,000,000 - 561,794,515561,794,515 - 561,794,515561,794,515 - 561,794,515561,794,515 - 561,794,515561,794,515 - 561,794,5150 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 150,000,000150,000,000 - 175,000,000175,000,000 - 200,000,000200,000,000 - 225,000,000225,000,000 - 250,000,000250,000,000 - 275,000,000275,000,000 - 300,000,000300,000,000 - 325,000,000325,000,000 - 350,000,000350,000,000 - 375,000,000375,000,000 - 400,000,000400,000,000 - 425,000,000425,000,000 - 450,000,000450,000,000 - 475,000,000475,000,000 - 500,000,000500,000,000 - 525,000,000525,000,000 - 550,000,000550,000,000 - 575,000,000575,000,000 - 600,000,000600,000,000 - 625,000,000625,000,000 - 632,540,561632,540,561 - 632,540,5610 - 25,000,00025,000,000 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,05329,223,053 - 29,223,053 Chromosome image

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.