About This Database    FAQs   Our Collaborators

Annotated species Coffea canephora Annotation built on Coffee Consortium 1.0 Total number of genes 25,574
Library type PARE Total bp in genome 569,911,005 Protein coding 25,574
Total number of libraries 7 Total chrs or contigs 12 Transposon related 0

This data in this site are largely from a collaboration with the lab of Antonio Chalfun Junior at the Universidade Federal de Lavras, Brazil. The data were included in a joint publication.

Some data contributed by: Antonio Chalfun Junior (Universidade Federal de Lavras).

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query

e.g. GSCOCG00012439001
Cluster or coordinate ID
Bulk Query

e.g. COFFEE_CONSORTIUM1.1.2001.500 (cluster)   COFFEE_CONSORTIUM1.1.2001.4500 (coordinate)
Sequence of PARE read
Bulk Query
e.g. ATCCCATTTGCTGGCCCTTT
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position. Note that if the genome has a mix of both chromosomes and small contigs or scaffolds, we only show images for the defined chromosomes, and contigs must be accessed via their ID.

0 - 25,000,00025,000,000 - 38,193,40038,193,400 - 38,193,40038,193,400 - 38,193,40038,193,400 - 38,193,40038,193,400 - 38,193,40038,193,400 - 38,193,40038,193,400 - 38,193,40038,193,400 - 38,193,4000 - 25,000,00025,000,000 - 50,000,00050,000,000 - 54,522,92854,522,928 - 54,522,92854,522,928 - 54,522,92854,522,928 - 54,522,92854,522,928 - 54,522,92854,522,928 - 54,522,92854,522,928 - 54,522,9280 - 25,000,00025,000,000 - 32,030,95132,030,951 - 32,030,95132,030,951 - 32,030,95132,030,951 - 32,030,95132,030,951 - 32,030,95132,030,951 - 32,030,95132,030,951 - 32,030,95132,030,951 - 32,030,9510 - 25,000,00025,000,000 - 28,191,98528,191,985 - 28,191,98528,191,985 - 28,191,98528,191,985 - 28,191,98528,191,985 - 28,191,98528,191,985 - 28,191,98528,191,985 - 28,191,98528,191,985 - 28,191,9850 - 25,000,00025,000,000 - 29,137,93529,137,935 - 29,137,93529,137,935 - 29,137,93529,137,935 - 29,137,93529,137,935 - 29,137,93529,137,935 - 29,137,93529,137,935 - 29,137,93529,137,935 - 29,137,9350 - 25,000,00025,000,000 - 37,293,96537,293,965 - 37,293,96537,293,965 - 37,293,96537,293,965 - 37,293,96537,293,965 - 37,293,96537,293,965 - 37,293,96537,293,965 - 37,293,96537,293,965 - 37,293,9650 - 25,000,00025,000,000 - 29,833,12029,833,120 - 29,833,12029,833,120 - 29,833,12029,833,120 - 29,833,12029,833,120 - 29,833,12029,833,120 - 29,833,12029,833,120 - 29,833,12029,833,120 - 29,833,1200 - 25,000,00025,000,000 - 31,585,74431,585,744 - 31,585,74431,585,744 - 31,585,74431,585,744 - 31,585,74431,585,744 - 31,585,74431,585,744 - 31,585,74431,585,744 - 31,585,74431,585,744 - 31,585,7440 - 22,352,17722,352,177 - 22,352,17722,352,177 - 22,352,17722,352,177 - 22,352,17722,352,177 - 22,352,17722,352,177 - 22,352,17722,352,177 - 22,352,17722,352,177 - 22,352,17722,352,177 - 22,352,1770 - 25,000,00025,000,000 - 27,624,74827,624,748 - 27,624,74827,624,748 - 27,624,74827,624,748 - 27,624,74827,624,748 - 27,624,74827,624,748 - 27,624,74827,624,748 - 27,624,74827,624,748 - 27,624,7480 - 25,000,00025,000,000 - 33,540,65633,540,656 - 33,540,65633,540,656 - 33,540,65633,540,656 - 33,540,65633,540,656 - 33,540,65633,540,656 - 33,540,65633,540,656 - 33,540,65633,540,656 - 33,540,6560 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 150,000,000150,000,000 - 175,000,000175,000,000 - 200,000,000200,000,000 - 205,603,396 Chromosome image

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.