About This Database

FAQs   Our Collaborators

Annotated species Zea mays (B73) Annotation built on Maize Genetics and Genomics Database v5 Total number of genes 914,018
Library type PARE Total bp in genome 2,183,123,008 Protein coding 47,555
Total number of libraries 9 Total chrs or contigs 13 Transposon related 866,463

The maize PARE data on this site comes from public sources such as those submitted to Genbank from published papers, and may include some of our own published libraries, such as those in this article in PNAS.

Some data contributed by: Virginia Walbot (Stanford University).

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query

e.g. TE_homo_108347
Cluster or coordinate ID
Bulk Query
Gramene assembly converter

e.g. MAIZE_B73v5.1.2001.500 (cluster)   MAIZE_B73v5.1.2001.4500 (coordinate)
Sequence of PARE read
Bulk Query
e.g. ATTCTTGGATTTCTGGTGGA
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position. Note that if the genome has a mix of both chromosomes and small contigs or scaffolds, we only show images for the defined chromosomes, and contigs must be accessed via their ID.

0 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 170,000,000170,000,000 - 180,000,000180,000,000 - 190,000,000190,000,000 - 200,000,000200,000,000 - 210,000,000210,000,000 - 220,000,000220,000,000 - 230,000,000230,000,000 - 240,000,000240,000,000 - 250,000,000250,000,000 - 260,000,000260,000,000 - 270,000,000270,000,000 - 280,000,000280,000,000 - 290,000,000290,000,000 - 300,000,000300,000,000 - 308,452,4710 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 170,000,000170,000,000 - 180,000,000180,000,000 - 190,000,000190,000,000 - 200,000,000200,000,000 - 210,000,000210,000,000 - 220,000,000220,000,000 - 230,000,000230,000,000 - 240,000,000240,000,000 - 243,675,191243,675,191 - 243,675,191243,675,191 - 243,675,191243,675,191 - 243,675,191243,675,191 - 243,675,191243,675,191 - 243,675,191243,675,191 - 243,675,1910 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 170,000,000170,000,000 - 180,000,000180,000,000 - 190,000,000190,000,000 - 200,000,000200,000,000 - 210,000,000210,000,000 - 220,000,000220,000,000 - 230,000,000230,000,000 - 238,017,767238,017,767 - 238,017,767238,017,767 - 238,017,767238,017,767 - 238,017,767238,017,767 - 238,017,767238,017,767 - 238,017,767238,017,767 - 238,017,767238,017,767 - 238,017,7670 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 170,000,000170,000,000 - 180,000,000180,000,000 - 190,000,000190,000,000 - 200,000,000200,000,000 - 210,000,000210,000,000 - 220,000,000220,000,000 - 230,000,000230,000,000 - 240,000,000240,000,000 - 250,000,000250,000,000 - 250,330,460250,330,460 - 250,330,460250,330,460 - 250,330,460250,330,460 - 250,330,460250,330,460 - 250,330,460250,330,460 - 250,330,4600 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 170,000,000170,000,000 - 180,000,000180,000,000 - 190,000,000190,000,000 - 200,000,000200,000,000 - 210,000,000210,000,000 - 220,000,000220,000,000 - 226,353,449226,353,449 - 226,353,449226,353,449 - 226,353,449226,353,449 - 226,353,449226,353,449 - 226,353,449226,353,449 - 226,353,449226,353,449 - 226,353,449226,353,449 - 226,353,449226,353,449 - 226,353,4490 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 170,000,000170,000,000 - 180,000,000180,000,000 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,234181,357,234 - 181,357,2340 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 170,000,000170,000,000 - 180,000,000180,000,000 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,916185,808,916 - 185,808,9160 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 170,000,000170,000,000 - 180,000,000180,000,000 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,202182,411,202 - 182,411,2020 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 160,000,000160,000,000 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,744163,004,744 - 163,004,7440 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 80,000,00080,000,000 - 90,000,00090,000,000 - 100,000,000100,000,000 - 110,000,000110,000,000 - 120,000,000120,000,000 - 130,000,000130,000,000 - 140,000,000140,000,000 - 150,000,000150,000,000 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,371152,435,371 - 152,435,3710 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,18950,566,189 - 50,566,1890 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,384140,384 - 140,3840 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630569,630 - 569,630 Chromosome image

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.