About This Database    FAQs

Annotated species Nicotiana benthamiana Annotation built on Nicotiana benthamiana Sequencing Consortium v1.03 Total number of genes 48,932
Library type small RNA Total bp in genome 2,835,009,601 Protein coding 48,932
Total number of libraries 61 Total chrs or contigs 20 Transposon related 0
The number of genomic-matches per small RNA ("hits") has been capped in this database at the following maximum: 50   (?)

This website was set up to organize public SRA data that we downloaded and also our own Meyers lab libraries, as part of our focus on Solanaceous small RNAs. The latter work was published in 2022 in Plant Physiology.

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query

e.g. NbL01g00010
Cluster or coordinate ID
Bulk Query

e.g. NBENTHI_LAB360.1.2001.500 (cluster)   NBENTHI_LAB360.1.2001.4500 (coordinate)
Sequence of small RNA read
Bulk Query
e.g. AAAAATTACTATAAACTCTT
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position. Note that if the genome has a mix of both chromosomes and small contigs or scaffolds, we only show images for the defined chromosomes, and contigs must be accessed via their ID.

0 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 131,735,028131,735,028 - 131,735,028131,735,028 - 131,735,0280 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 141,867,802141,867,802 - 141,867,802141,867,802 - 141,867,8020 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 129,979,819129,979,819 - 129,979,819129,979,819 - 129,979,8190 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 134,308,249134,308,249 - 134,308,249134,308,249 - 134,308,2490 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 149,457,545149,457,545 - 149,457,545149,457,545 - 149,457,5450 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 146,022,827146,022,827 - 146,022,827146,022,827 - 146,022,8270 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 141,749,984141,749,984 - 141,749,984141,749,984 - 141,749,9840 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 143,140,102143,140,102 - 143,140,102143,140,102 - 143,140,1020 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 144,579,968144,579,968 - 144,579,968144,579,968 - 144,579,9680 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 143,192,947143,192,947 - 143,192,947143,192,947 - 143,192,9470 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 128,920,113128,920,113 - 128,920,113128,920,113 - 128,920,1130 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 144,318,985144,318,985 - 144,318,985144,318,985 - 144,318,9850 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 141,579,612141,579,612 - 141,579,612141,579,612 - 141,579,6120 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 131,312,197131,312,197 - 131,312,197131,312,197 - 131,312,1970 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 150,000,000150,000,000 - 175,000,000175,000,000 - 176,759,2080 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 150,000,000150,000,000 - 175,000,000175,000,000 - 176,986,1270 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 150,000,000150,000,000 - 175,000,000175,000,000 - 182,027,1950 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 141,222,746141,222,746 - 141,222,746141,222,746 - 141,222,7460 - 25,000,00025,000,000 - 50,000,00050,000,000 - 75,000,00075,000,000 - 100,000,000100,000,000 - 125,000,000125,000,000 - 141,342,579141,342,579 - 141,342,579141,342,579 - 141,342,5790 - 25,000,00025,000,000 - 50,000,00050,000,000 - 64,506,56864,506,568 - 64,506,56864,506,568 - 64,506,56864,506,568 - 64,506,56864,506,568 - 64,506,56864,506,568 - 64,506,568 Chromosome image

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.