About This Database

FAQs Our Collaborators

Annotated species	Nicotiana tabacum	Annotation built on	British American Tobacco v4.5	Total number of genes	72,792
Library type	small RNA	Total bp in genome	4,695,104,741	Protein coding	72,792
Total number of libraries	78	Total chrs or contigs	1,084,433	Transposon related	0

The number of genomic-matches per small RNA ("hits") has been capped in this database at the following maximum: 50 (?)

Note: The scaffold IDs (originally 450000001 - 451084432) are displayed as 1 - 1084432. The chloloplast is displayed as 1084433.

The small RNA data are described in The Plant Cell, a collaboration with Keith Slotkin (Donald Danforth Plant Science Center) and Jeff Staub (Plastomics). Data were submitted to SRA under BioProject PRJNA907077.

Some data contributed by: Keith Slotkin (Donald Danforth Plant Science Center), Jeff Staub (Plastomics).

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID Bulk Query	Enter protein or gene ID Gene analysis viewer Library abundance viewer e.g. 0000001g0010
Cluster or coordinate ID Bulk Query	Cluster ID ('TOBACCO_Nitabv4_5.[chr_id].[start].[length]') Coordinate ID ('TOBACCO_Nitabv4_5.[chr_id].[start].[end]') Enter cluster or coordinate ID e.g. TOBACCO_Nitabv4_5.1.2001.500 (cluster) TOBACCO_Nitabv4_5.1.2001.4500 (coordinate)
Sequence of small RNA read Bulk Query	Enter sequence of read e.g. AAGCGTTAGGTTAGCTTGAA
Keyword for genes/proteins or repeats	Genes Repeats Enter keyword for genes, proteins, or repeats e.g. MIRNA LTR

Query by Chromosome Position

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.