About This Database

FAQs   Our Collaborators

Annotated species Nicotiana tabacum Annotation built on British American Tobacco v4.5 Total number of genes 72,792
Library type small RNA Total bp in genome 4,695,104,741 Protein coding 72,792
Total number of libraries 78 Total chrs or contigs 1,084,433 Transposon related 0

The number of genomic-matches per small RNA ("hits") has been capped in this database at the following maximum: 50   (?)

Note: The scaffold IDs (originally 450000001 - 451084432) are displayed as 1 - 1084432. The chloloplast is displayed as 1084433.

The small RNA data are described in The Plant Cell, a collaboration with Keith Slotkin (Donald Danforth Plant Science Center) and Jeff Staub (Plastomics). Data were submitted to SRA under BioProject PRJNA907077.

Some data contributed by: Keith Slotkin (Donald Danforth Plant Science Center), Jeff Staub (Plastomics).

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query

e.g. 0000001g0010
Cluster or coordinate ID
Bulk Query

e.g. TOBACCO_Nitabv4_5.1.2001.500 (cluster)   TOBACCO_Nitabv4_5.1.2001.4500 (coordinate)
Sequence of small RNA read
Bulk Query
e.g. AAGCGTTAGGTTAGCTTGAA
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.