Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: AAACGAACAAAAAACTGATGG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w6,521,053Phasing windowAT1G18879w6,520,9416,521,124MIR837a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21w6,521,053Phasing windowAT1G18880w6,520,7486,523,368Major facilitator superfamily protein
31w6,521,053Phasing windowath-MIR837w6,520,9416,521,124miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F114,877,516  1112
C0F222,789,465  1147
d1F103,574,742  0000
d1F203,705,660  0000
d234F121,417,116  13714
d234F21033,822,319  2754135269
r2F142,195,923  24918
r2F2292,233,522  132665130
r2FSb1015,728,276  183588176
r2FNaSb505,311,047  9194794
r2FNa101,834,656  0000
r2FNa2476,081,068  8153977
r2FL51,145,942  492244
r2FD354,928,142  7143671
C0FCSb09,399,678  0000
C0FSb59,361,008  1135
r2SC1163,743,342  492143
r2SH552,165,395  2551127254
r2SNa102,082,930  0000
r2SC3713,997,922  183689178
r2SNa21874,617,795  4081202405
r2SSb1713,278,680  52104261522
r2SNaSb433,087,212  142870139
r2SC20476,105  0000
r2SP3976,646  361531
C0RC161,249,181  5102448
C0RNi121,211,490  10205099
AtCM014,488,208  0000
AT_Leaf908,047,907  112256112
At_miR1507OX_111,478,373  1137
At_miR1507OX_221,638,916  12612
At_miR2109OX_101,760,055  0000
At_miR2109OX_212,446,954  1124
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_112,023,619  1125
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_121,995,522  12510
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_221,804,409  12611
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-144,328,718  1259
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-118,736,008  1111
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4413,435,030  1113
Wt_d07,517,450  0000
Col_d011,692,099  0000


Link to FindMiRNA for this sequence