Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: AAGGAGTGGCATGTGAACACA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	w	1,040,948	Phasing window	AT2G03445	w	1,040,938	1,041,042	MIR398A; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	w	1,040,948	Phasing window	ath-MIR398a	w	1,040,938	1,041,042	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	19	4,877,516	4	8	19	39
C0F2	2	2,789,465	1	1	4	7
d1F1	23	3,574,742	6	13	32	64
d1F2	5	3,705,660	1	3	7	13
d234F1	44	1,417,116	31	62	155	310
d234F2	38	3,822,319	10	20	50	99
r2F1	190	2,195,923	87	173	433	865
r2F2	92	2,233,522	41	82	206	412
r2FSb	646	5,728,276	113	226	564	1,128
r2FNaSb	554	5,311,047	104	209	522	1,043
r2FNa1	278	1,834,656	152	303	758	1,515
r2FNa2	1,008	6,081,068	166	332	829	1,658
r2FL	143	1,145,942	125	250	624	1,248
r2FD	566	4,928,142	115	230	574	1,149
C0FCSb	6	9,399,678	1	1	3	6
C0FSb	46	9,361,008	5	10	25	49
r2SC1	83	3,743,342	22	44	111	222
r2SH	285	2,165,395	132	263	658	1,316
r2SNa1	55	2,082,930	26	53	132	264
r2SC3	440	3,997,922	110	220	550	1,101
r2SNa2	367	4,617,795	79	159	397	795
r2SSb	676	3,278,680	206	412	1,031	2,062
r2SNaSb	455	3,087,212	147	295	737	1,474
r2SC2	5	476,105	11	21	53	105
r2SP	27	976,646	28	55	138	276
C0RC1	9	1,249,181	7	14	36	72
C0RNi	4	1,211,490	3	7	17	33
AtCM	7	14,488,208	1	1	2	5
AT_Leaf	472	8,047,907	59	117	293	586
At_miR1507OX_1	170	1,478,373	115	230	575	1,150
At_miR1507OX_2	123	1,638,916	75	150	375	750
At_miR2109OX_1	67	1,760,055	38	76	190	381
At_miR2109OX_2	270	2,446,954	110	221	552	1,103
At_miR2118aOX_1	60	1,212,493	49	99	247	495
At_miR2118aOX_2	112	1,258,140	89	178	445	890
At_miR2118bOX_1	75	2,023,619	37	74	185	371
At_miR2118bOX_2	68	1,733,586	39	78	196	392
At_miR2118cOX_1	366	1,995,522	183	367	917	1,834
At_miR2118cOX_2	209	2,496,180	84	167	419	837
At_miROX_control	23	1,838,508	13	25	63	125
At_miROX_ck_2	28	1,804,409	16	31	78	155
hen1-8	3	5,456,831	1	1	3	5
hen1-8 ntp2-1	9	6,244,400	1	3	7	14
hen1-8 urt1-1	4	6,081,292	1	1	3	7
hen1-8 ntp4-1	2	4,626,878	1	1	2	4
hen1-8 ntp5-1	11	5,676,073	2	4	10	19
hen1-8 ntp6-1	48	4,328,718	11	22	55	111
hen1-8 ntp7-1	4	4,409,080	1	2	5	9
hen1-8 ntp8-1	7	8,736,008	1	2	4	8
hen1-8 ntp10-1	7	6,387,459	1	2	5	11
hen1-8 r2	1	2,874,203	1	1	2	3
hen1-8 heso1-1	4	6,015,054	1	1	3	7
hen1-8 mee44	0	3,435,030	0	0	0	0
Wt_d	18	7,517,450	2	5	12	24
Col_d	60	11,692,099	5	10	26	51

Link to FindMiRNA for this sequence