Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: AATGCGCAACTCTATATTTCC
Length: 21 nucleotides
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
12c12,270,361Phasing windowLink to IGR (2,261 bp)Small region at sequence (3 kb)




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F223,705,660  1135
d234F101,417,116  0000
d234F223,822,319  1135
r2F102,195,923  0000
r2F2112,233,522  5102549
r2FSb65,728,276  12510
r2FNaSb25,311,047  1124
r2FNa101,834,656  0000
r2FNa236,081,068  1125
r2FL01,145,942  0000
r2FD44,928,142  1248
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC103,743,342  0000
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC323,997,922  1135
r2SNa204,617,795  0000
r2SSb13,278,680  1123
r2SNaSb03,087,212  0000
r2SC20476,105  0000
r2SP0976,646  0000
C0RC1971,249,181  78155388777
C0RNi51,211,490  482141
AtCM114,488,208  1111
AT_Leaf18,047,907  1111
At_miR1507OX_121,478,373  13714
At_miR1507OX_201,638,916  0000
At_miR2109OX_121,760,055  12611
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_142,023,619  241020
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_111,995,522  1135
At_miR2118cOX_202,496,180  0000
At_miROX_control31,838,508  23816
At_miROX_ck_201,804,409  0000
hen1-825,456,831  1124
hen1-8 ntp2-126,244,400  1123
hen1-8 urt1-136,081,292  1125
hen1-8 ntp4-144,626,878  1249
hen1-8 ntp5-1105,676,073  24918
hen1-8 ntp6-1514,328,718  122459118
hen1-8 ntp7-164,409,080  13714
hen1-8 ntp8-138,736,008  1123
hen1-8 ntp10-156,387,459  1248
hen1-8 r242,874,203  13714
hen1-8 heso1-116,015,054  1112
hen1-8 mee4423,435,030  1136
Wt_d07,517,450  0000
Col_d1111,692,099  1259


Link to FindMiRNA for this sequence