Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: AATTAAAGATTTCATCTTACT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
12w15,611,953Phasing windowAT2G37160w15,608,82715,612,934unknown function

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
22w15,611,953Phasing windowath-MIR1886w15,611,87015,611,982miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F212,789,465  1124
d1F143,574,742  12611
d1F243,705,660  12511
d234F121,417,116  13714
d234F253,822,319  13713
r2F152,195,923  251123
r2F2602,233,522  2754134269
r2FSb75,728,276  12612
r2FNaSb55,311,047  1259
r2FNa191,834,656  5102549
r2FNa266,081,068  12510
r2FL161,145,942  142870140
r2FD84,928,142  23816
C0FCSb19,399,678  1111
C0FSb09,361,008  0000
r2SC113,743,342  1113
r2SH92,165,395  482142
r2SNa102,082,930  0000
r2SC303,997,922  0000
r2SNa234,617,795  1136
r2SSb33,278,680  1259
r2SNaSb13,087,212  1123
r2SC20476,105  0000
r2SP0976,646  0000
C0RC181,249,181  6133264
C0RNi21,211,490  23817
AtCM2114,488,208  13714
AT_Leaf48,047,907  1125
At_miR1507OX_181,478,373  5112754
At_miR1507OX_241,638,916  251224
At_miR2109OX_101,760,055  0000
At_miR2109OX_252,446,954  241020
At_miR2118aOX_111,212,493  1248
At_miR2118aOX_231,258,140  251224
At_miR2118bOX_142,023,619  241020
At_miR2118bOX_251,733,586  361429
At_miR2118cOX_121,995,522  12510
At_miR2118cOX_202,496,180  0000
At_miROX_control11,838,508  1135
At_miROX_ck_241,804,409  241122
hen1-815,456,831  1112
hen1-8 ntp2-126,244,400  1123
hen1-8 urt1-136,081,292  1125
hen1-8 ntp4-114,626,878  1112
hen1-8 ntp5-115,676,073  1112
hen1-8 ntp6-1164,328,718  471837
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-136,387,459  1125
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d207,517,450  351327
Col_d111,692,099  1111


Link to FindMiRNA for this sequence