Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: ACAAAATCCGTCTTTGAAGA
Length: 20 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15c16,157,857Phasing windowAT5G40384c16,157,82316,157,948MIR866a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
25c16,157,857Phasing windowath-MIR866c16,157,82316,157,948miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F111,417,116  1147
d234F223,822,319  1135
r2F102,195,923  0000
r2F202,233,522  0000
r2FSb95,728,276  23816
r2FNaSb165,311,047  361530
r2FNa111,834,656  1135
r2FNa2116,081,068  24918
r2FL01,145,942  0000
r2FD64,928,142  12612
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC103,743,342  0000
r2SH82,165,395  471837
r2SNa102,082,930  0000
r2SC323,997,922  1135
r2SNa214,617,795  1112
r2SSb33,278,680  1259
r2SNaSb13,087,212  1123
r2SC21476,105  241121
r2SP0976,646  0000
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM014,488,208  0000
AT_Leaf738,047,907  9184591
At_miR1507OX_171,478,373  592447
At_miR1507OX_221,638,916  12612
At_miR2109OX_101,760,055  0000
At_miR2109OX_282,446,954  371633
At_miR2118aOX_111,212,493  1248
At_miR2118aOX_211,258,140  1248
At_miR2118bOX_122,023,619  12510
At_miR2118bOX_211,733,586  1136
At_miR2118cOX_1111,995,522  6112855
At_miR2118cOX_242,496,180  23816
At_miROX_control71,838,508  481938
At_miROX_ck_221,804,409  12611
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-114,328,718  1112
hen1-8 ntp7-114,409,080  1112
hen1-8 ntp8-118,736,008  1111
hen1-8 ntp10-106,387,459  0000
hen1-8 r212,874,203  1123
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d47,517,450  1135
Col_d911,692,099  1248


Link to FindMiRNA for this sequence