Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: ACAAAGTTTTATACTGACAAT
Length: 21 nucleotides
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15w21,161,609Phasing windowAT5G52070w21,161,31121,165,025Agenet domain-containing protein




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F134,877,516  1136
C0F202,789,465  0000
d1F113,574,742  1113
d1F213,705,660  1113
d234F181,417,116  6112856
d234F2293,822,319  8153876
r2F1282,195,923  132664128
r2F2562,233,522  2550125251
r2FSb215,728,276  471837
r2FNaSb115,311,047  241021
r2FNa1161,834,656  9174487
r2FNa296,081,068  13715
r2FL361,145,942  3163157314
r2FD174,928,142  371734
C0FCSb09,399,678  0000
C0FSb19,361,008  1111
r2SC193,743,342  251224
r2SH202,165,395  9184692
r2SNa1132,082,930  6123162
r2SC323,997,922  1135
r2SNa224,617,795  1124
r2SSb03,278,680  0000
r2SNaSb23,087,212  1136
r2SC25476,105  112153105
r2SP0976,646  0000
C0RC131,249,181  251224
C0RNi41,211,490  371733
AtCM814,488,208  1136
AT_Leaf08,047,907  0000
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_111,995,522  1135
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_211,804,409  1136
hen1-805,456,831  0000
hen1-8 ntp2-116,244,400  1112
hen1-8 urt1-126,081,292  1123
hen1-8 ntp4-124,626,878  1124
hen1-8 ntp5-145,676,073  1147
hen1-8 ntp6-1114,328,718  351325
hen1-8 ntp7-114,409,080  1112
hen1-8 ntp8-178,736,008  1248
hen1-8 ntp10-116,387,459  1112
hen1-8 r222,874,203  1137
hen1-8 heso1-106,015,054  0000
hen1-8 mee4423,435,030  1136
Wt_d1557,517,450  2141103206
Col_d111,692,099  1111


Link to FindMiRNA for this sequence