Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: ACACTGAAGGACCTAAACTAAC
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	c	771,513	Phasing window	AT2G02741	c	771,377	771,522	MIR840a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	c	771,513	Phasing window	AT2G02750	c	771,151	773,540	Pentatricopeptide repeat (PPR) superfamily protein
3	2	c	771,513	Phasing window	ath-MIR840	c	771,337	771,562	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	0	4,877,516	0	0	0	0
C0F2	0	2,789,465	0	0	0	0
d1F1	3	3,574,742	1	2	4	8
d1F2	8	3,705,660	2	4	11	22
d234F1	0	1,417,116	0	0	0	0
d234F2	0	3,822,319	0	0	0	0
r2F1	26	2,195,923	12	24	59	118
r2F2	13	2,233,522	6	12	29	58
r2FSb	58	5,728,276	10	20	51	101
r2FNaSb	77	5,311,047	14	29	72	145
r2FNa1	9	1,834,656	5	10	25	49
r2FNa2	99	6,081,068	16	33	81	163
r2FL	13	1,145,942	11	23	57	113
r2FD	63	4,928,142	13	26	64	128
C0FCSb	1	9,399,678	1	1	1	1
C0FSb	1	9,361,008	1	1	1	1
r2SC1	5	3,743,342	1	3	7	13
r2SH	0	2,165,395	0	0	0	0
r2SNa1	9	2,082,930	4	9	22	43
r2SC3	16	3,997,922	4	8	20	40
r2SNa2	35	4,617,795	8	15	38	76
r2SSb	27	3,278,680	8	16	41	82
r2SNaSb	11	3,087,212	4	7	18	36
r2SC2	0	476,105	0	0	0	0
r2SP	1	976,646	1	2	5	10
C0RC1	0	1,249,181	0	0	0	0
C0RNi	4	1,211,490	3	7	17	33
AtCM	0	14,488,208	0	0	0	0
AT_Leaf	119	8,047,907	15	30	74	148
At_miR1507OX_1	26	1,478,373	18	35	88	176
At_miR1507OX_2	19	1,638,916	12	23	58	116
At_miR2109OX_1	11	1,760,055	6	12	31	62
At_miR2109OX_2	52	2,446,954	21	43	106	213
At_miR2118aOX_1	17	1,212,493	14	28	70	140
At_miR2118aOX_2	24	1,258,140	19	38	95	191
At_miR2118bOX_1	35	2,023,619	17	35	86	173
At_miR2118bOX_2	27	1,733,586	16	31	78	156
At_miR2118cOX_1	42	1,995,522	21	42	105	210
At_miR2118cOX_2	31	2,496,180	12	25	62	124
At_miROX_control	28	1,838,508	15	30	76	152
At_miROX_ck_2	13	1,804,409	7	14	36	72
hen1-8	72	5,456,831	13	26	66	132
hen1-8 ntp2-1	86	6,244,400	14	28	69	138
hen1-8 urt1-1	202	6,081,292	33	66	166	332
hen1-8 ntp4-1	99	4,626,878	21	43	107	214
hen1-8 ntp5-1	376	5,676,073	66	132	331	662
hen1-8 ntp6-1	2,549	4,328,718	589	1,178	2,944	5,889
hen1-8 ntp7-1	106	4,409,080	24	48	120	240
hen1-8 ntp8-1	204	8,736,008	23	47	117	234
hen1-8 ntp10-1	133	6,387,459	21	42	104	208
hen1-8 r2	38	2,874,203	13	26	66	132
hen1-8 heso1-1	77	6,015,054	13	26	64	128
hen1-8 mee44	44	3,435,030	13	26	64	128
Wt_d	4	7,517,450	1	1	3	5
Col_d	89	11,692,099	8	15	38	76

Link to FindMiRNA for this sequence