Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: ACAGTGGTCATCTGGTGGGCT
Length: 21 nucleotides
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15w14,100,017Phasing windowLink to IGR (10,666 bp)Small region at sequence (3 kb)




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F203,822,319  0000
r2F102,195,923  0000
r2F202,233,522  0000
r2FSb35,728,276  1135
r2FNaSb25,311,047  1124
r2FNa121,834,656  12511
r2FNa246,081,068  1137
r2FL01,145,942  0000
r2FD34,928,142  1136
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC123,743,342  1135
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC373,997,922  24918
r2SNa2314,617,795  7133467
r2SSb73,278,680  241121
r2SNaSb33,087,212  12510
r2SC210476,105  2142105210
r2SP7976,646  7143672
C0RC1171,249,181  142768136
C0RNi251,211,490  2141103206
AtCM014,488,208  0000
AT_Leaf18,047,907  1111
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-114,626,878  1112
hen1-8 ntp5-115,676,073  1112
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d07,517,450  0000
Col_d011,692,099  0000


Link to FindMiRNA for this sequence