Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: ACATATGATCTGCATCTTTGC
Length: 21 nucleotides
Number of hits: 2

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
12w10,026,979Phasing windowLink to IGR (1,353 bp)Small region at sequence (3 kb)

Other perfect matches found in genome in addition to that listed above.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
22c10,027,030Phasing windowLink to IGR (1,353 bp)Small region at sequence (3 kb)




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F124,877,516  1124
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F111,417,116  1147
d234F203,822,319  0000
r2F162,195,923  351427
r2F292,233,522  482040
r2FSb165,728,276  361428
r2FNaSb125,311,047  251123
r2FNa121,834,656  12511
r2FNa2116,081,068  24918
r2FL41,145,942  371735
r2FD114,928,142  241122
C0FCSb09,399,678  0000
C0FSb19,361,008  1111
r2SC113,743,342  1113
r2SH102,165,395  592346
r2SNa102,082,930  0000
r2SC313,997,922  1113
r2SNa244,617,795  1249
r2SSb03,278,680  0000
r2SNaSb13,087,212  1123
r2SC23476,105  6133263
r2SP2976,646  241020
C0RC1481,249,181  3877192384
C0RNi1131,211,490  93187466933
AtCM214,488,208  1111
AT_Leaf28,047,907  1112
At_miR1507OX_111,478,373  1137
At_miR1507OX_201,638,916  0000
At_miR2109OX_111,760,055  1136
At_miR2109OX_212,446,954  1124
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_211,258,140  1248
At_miR2118bOX_152,023,619  251225
At_miR2118bOX_211,733,586  1136
At_miR2118cOX_121,995,522  12510
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-865,456,831  12511
hen1-8 ntp2-176,244,400  12611
hen1-8 urt1-1146,081,292  251223
hen1-8 ntp4-144,626,878  1249
hen1-8 ntp5-1105,676,073  24918
hen1-8 ntp6-1344,328,718  8163979
hen1-8 ntp7-134,409,080  1137
hen1-8 ntp8-1128,736,008  13714
hen1-8 ntp10-146,387,459  1136
hen1-8 r262,874,203  241021
hen1-8 heso1-166,015,054  12510
hen1-8 mee4413,435,030  1113
Wt_d137,517,450  23917
Col_d1411,692,099  12612


Link to FindMiRNA for this sequence