Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: ACTCATAAGATCGTGACACGT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 2

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	4	w	7,844,612	Phasing window	AT4G13495	w	7,842,967	7,846,774	other RNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	4	w	7,844,612	Phasing window	ath-MIR5026	w	7,844,496	7,844,688	miRNA
3	4	w	7,844,612	Phasing window	AT4G13495	w	7,842,967	7,846,774	other RNA
4	4	w	7,844,612	Phasing window	ath-MIR5026	w	7,844,496	7,844,688	miRNA
5	5	c	14,318,750	Phasing window	Link to IGR (4,615 bp)			Small region at sequence (3 kb)

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	158	4,877,516	32	65	162	324
C0F2	52	2,789,465	19	37	93	186
d1F1	111	3,574,742	31	62	155	311
d1F2	624	3,705,660	168	337	842	1,684
d234F1	222	1,417,116	157	313	783	1,567
d234F2	1,961	3,822,319	513	1,026	2,565	5,130
r2F1	624	2,195,923	284	568	1,421	2,842
r2F2	710	2,233,522	318	636	1,589	3,179
r2FSb	2,880	5,728,276	503	1,006	2,514	5,028
r2FNaSb	2,512	5,311,047	473	946	2,365	4,730
r2FNa1	313	1,834,656	171	341	853	1,706
r2FNa2	2,425	6,081,068	399	798	1,994	3,988
r2FL	193	1,145,942	168	337	842	1,684
r2FD	2,186	4,928,142	444	887	2,218	4,436
C0FCSb	11	9,399,678	1	2	6	12
C0FSb	67	9,361,008	7	14	36	72
r2SC1	8,868	3,743,342	2,369	4,738	11,845	23,690
r2SH	9,265	2,165,395	4,279	8,557	21,393	42,787
r2SNa1	3,793	2,082,930	1,821	3,642	9,105	18,210
r2SC3	6,370	3,997,922	1,593	3,187	7,967	15,933
r2SNa2	10,597	4,617,795	2,295	4,590	11,474	22,948
r2SSb	10,352	3,278,680	3,157	6,315	15,787	31,574
r2SNaSb	6,861	3,087,212	2,222	4,445	11,112	22,224
r2SC2	3,880	476,105	8,149	16,299	40,747	81,495
r2SP	3,178	976,646	3,254	6,508	16,270	32,540
C0RC1	55	1,249,181	44	88	220	440
C0RNi	117	1,211,490	97	193	483	966
AtCM	4	14,488,208	1	1	1	3
AT_Leaf	4,065	8,047,907	505	1,010	2,526	5,051
At_miR1507OX_1	148	1,478,373	100	200	501	1,001
At_miR1507OX_2	236	1,638,916	144	288	720	1,440
At_miR2109OX_1	104	1,760,055	59	118	295	591
At_miR2109OX_2	167	2,446,954	68	136	341	682
At_miR2118aOX_1	73	1,212,493	60	120	301	602
At_miR2118aOX_2	146	1,258,140	116	232	580	1,160
At_miR2118bOX_1	233	2,023,619	115	230	576	1,151
At_miR2118bOX_2	161	1,733,586	93	186	464	929
At_miR2118cOX_1	222	1,995,522	111	222	556	1,112
At_miR2118cOX_2	244	2,496,180	98	195	489	977
At_miROX_control	166	1,838,508	90	181	451	903
At_miROX_ck_2	216	1,804,409	120	239	599	1,197
hen1-8	34	5,456,831	6	12	31	62
hen1-8 ntp2-1	56	6,244,400	9	18	45	90
hen1-8 urt1-1	21	6,081,292	3	7	17	35
hen1-8 ntp4-1	10	4,626,878	2	4	11	22
hen1-8 ntp5-1	42	5,676,073	7	15	37	74
hen1-8 ntp6-1	274	4,328,718	63	127	316	633
hen1-8 ntp7-1	36	4,409,080	8	16	41	82
hen1-8 ntp8-1	37	8,736,008	4	8	21	42
hen1-8 ntp10-1	20	6,387,459	3	6	16	31
hen1-8 r2	13	2,874,203	5	9	23	45
hen1-8 heso1-1	25	6,015,054	4	8	21	42
hen1-8 mee44	27	3,435,030	8	16	39	79
Wt_d	178	7,517,450	24	47	118	237
Col_d	7	11,692,099	1	1	3	6

Link to FindMiRNA for this sequence