Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: ACTTGGCTGATTCTATTATT
Length: 20 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15c7,583,324Phasing windowAT5G22770c7,579,2637,588,249alpha-adaptin

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
25c7,583,324Phasing windowath-MIR3434c7,583,0557,583,403miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F223,822,319  1135
r2F122,195,923  1259
r2F282,233,522  471836
r2FSb25,728,276  1123
r2FNaSb15,311,047  1112
r2FNa101,834,656  0000
r2FNa226,081,068  1123
r2FL11,145,942  1249
r2FD24,928,142  1124
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC123,743,342  1135
r2SH02,165,395  0000
r2SNa192,082,930  492243
r2SC343,997,922  12510
r2SNa204,617,795  0000
r2SSb03,278,680  0000
r2SNaSb23,087,212  1136
r2SC21476,105  241121
r2SP0976,646  0000
C0RC141,249,181  361632
C0RNi11,211,490  1248
AtCM014,488,208  0000
AT_Leaf278,047,907  371734
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-126,244,400  1123
hen1-8 urt1-126,081,292  1123
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-114,328,718  1112
hen1-8 ntp7-114,409,080  1112
hen1-8 ntp8-118,736,008  1111
hen1-8 ntp10-116,387,459  1112
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4423,435,030  1136
Wt_d37,517,450  1124
Col_d311,692,099  1113


Link to FindMiRNA for this sequence