Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: ACTTTGAAGCTTTGATTTGAA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11c11,834,173Phasing windowAT1G32713c11,834,06811,834,180MIR829a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21c11,834,173Phasing windowath-MIR829c11,834,02211,834,226miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F144,877,516  1248
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F111,417,116  1147
d234F2143,822,319  471837
r2F152,195,923  251123
r2F2322,233,522  142972143
r2FSb625,728,276  112254108
r2FNaSb485,311,047  9184590
r2FNa161,834,656  371633
r2FNa2336,081,068  5112754
r2FL81,145,942  7143570
r2FD234,928,142  592347
C0FCSb09,399,678  0000
C0FSb49,361,008  1124
r2SC1103,743,342  351327
r2SH242,165,395  112255111
r2SNa102,082,930  0000
r2SC363,997,922  23815
r2SNa2194,617,795  482141
r2SSb153,278,680  592346
r2SNaSb203,087,212  6133265
r2SC223476,105  4897242483
r2SP14976,646  142972143
C0RC1771,249,181  62123308616
C0RNi1,9021,211,490  1,5703,1407,85015,700
AtCM014,488,208  0000
AT_Leaf148,047,907  23917
At_miR1507OX_101,478,373  0000
At_miR1507OX_211,638,916  1136
At_miR2109OX_111,760,055  1136
At_miR2109OX_202,446,954  0000
At_miR2118aOX_121,212,493  23816
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_112,023,619  1125
At_miR2118bOX_221,733,586  12612
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_211,804,409  1136
hen1-8165,456,831  361529
hen1-8 ntp2-1156,244,400  251224
hen1-8 urt1-1246,081,292  482039
hen1-8 ntp4-1234,626,878  5102550
hen1-8 ntp5-1235,676,073  482041
hen1-8 ntp6-1794,328,718  183791183
hen1-8 ntp7-1254,409,080  6112857
hen1-8 ntp8-1438,736,008  5102549
hen1-8 ntp10-1156,387,459  251223
hen1-8 r2132,874,203  592345
hen1-8 heso1-1126,015,054  241020
hen1-8 mee44123,435,030  371735
Wt_d497,517,450  7133365
Col_d9311,692,099  8164080


Link to FindMiRNA for this sequence