Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: AGAAGCAAAATGACGACTCGG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15w15,758,111Phasing windowath-MIR3933w15,758,10515,758,192miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F11184,877,516  2448121242
C0F212,789,465  1124
d1F1913,574,742  2551127255
d1F21083,705,660  2958146291
d234F12501,417,116  1763538821,764
d234F28773,822,319  2294591,1472,294
r2F13522,195,923  1603218011,603
r2F22322,233,522  1042085191,039
r2FSb2,1865,728,276  3827631,9083,816
r2FNaSb1,0915,311,047  2054111,0272,054
r2FNa11851,834,656  1012025041,008
r2FNa21,3966,081,068  2304591,1482,296
r2FL2441,145,942  2134261,0652,129
r2FD1,0344,928,142  2104201,0492,098
C0FCSb309,399,678  361632
C0FSb1189,361,008  132563126
r2SC183,743,342  241121
r2SH52,165,395  251223
r2SNa102,082,930  0000
r2SC303,997,922  0000
r2SNa254,617,795  12511
r2SSb33,278,680  1259
r2SNaSb03,087,212  0000
r2SC20476,105  0000
r2SP1976,646  12510
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM014,488,208  0000
AT_Leaf48,047,907  1125
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-8105,456,831  24918
hen1-8 ntp2-1116,244,400  24918
hen1-8 urt1-1106,081,292  23816
hen1-8 ntp4-194,626,878  241019
hen1-8 ntp5-1215,676,073  471837
hen1-8 ntp6-1704,328,718  163281162
hen1-8 ntp7-174,409,080  23816
hen1-8 ntp8-1198,736,008  241122
hen1-8 ntp10-176,387,459  12511
hen1-8 r2122,874,203  482142
hen1-8 heso1-1206,015,054  371733
hen1-8 mee44163,435,030  592347
Wt_d537,517,450  7143571
Col_d411,692,099  1123


Link to FindMiRNA for this sequence