Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: AGAAGCGTACAAGGAGATGAGG
Length: 22 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	w	10,247,259	Phasing window	AT2G24103	w	10,247,206	10,247,462	MIR831a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	w	10,247,259	Phasing window	ath-MIR831	w	10,247,206	10,247,462	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Separator	Normalization Denominator
Data type	Raw	Total	Separator	1M	2M	5M	10M
C0F1	0	4,877,516	Separator	0	0	0	0
C0F2	1	2,789,465	Separator	1	1	2	4
d1F1	0	3,574,742	Separator	0	0	0	0
d1F2	0	3,705,660	Separator	0	0	0	0
d234F1	0	1,417,116	Separator	0	0	0	0
d234F2	9	3,822,319	Separator	2	5	12	24
r2F1	2	2,195,923	Separator	1	2	5	9
r2F2	1	2,233,522	Separator	1	1	2	4
r2FSb	15	5,728,276	Separator	3	5	13	26
r2FNaSb	10	5,311,047	Separator	2	4	9	19
r2FNa1	1	1,834,656	Separator	1	1	3	5
r2FNa2	14	6,081,068	Separator	2	5	12	23
r2FL	0	1,145,942	Separator	0	0	0	0
r2FD	10	4,928,142	Separator	2	4	10	20
C0FCSb	2	9,399,678	Separator	1	1	1	2
C0FSb	0	9,361,008	Separator	0	0	0	0
r2SC1	0	3,743,342	Separator	0	0	0	0
r2SH	4	2,165,395	Separator	2	4	9	18
r2SNa1	0	2,082,930	Separator	0	0	0	0
r2SC3	0	3,997,922	Separator	0	0	0	0
r2SNa2	2	4,617,795	Separator	1	1	2	4
r2SSb	5	3,278,680	Separator	2	3	8	15
r2SNaSb	0	3,087,212	Separator	0	0	0	0
r2SC2	0	476,105	Separator	0	0	0	0
r2SP	0	976,646	Separator	0	0	0	0
C0RC1	0	1,249,181	Separator	0	0	0	0
C0RNi	0	1,211,490	Separator	0	0	0	0
AtCM	0	14,488,208	Separator	0	0	0	0
AT_Leaf	0	8,047,907	Separator	0	0	0	0
At_miR1507OX_1	0	1,478,373	Separator	0	0	0	0
At_miR1507OX_2	0	1,638,916	Separator	0	0	0	0
At_miR2109OX_1	0	1,760,055	Separator	0	0	0	0
At_miR2109OX_2	0	2,446,954	Separator	0	0	0	0
At_miR2118aOX_1	0	1,212,493	Separator	0	0	0	0
At_miR2118aOX_2	0	1,258,140	Separator	0	0	0	0
At_miR2118bOX_1	0	2,023,619	Separator	0	0	0	0
At_miR2118bOX_2	0	1,733,586	Separator	0	0	0	0
At_miR2118cOX_1	0	1,995,522	Separator	0	0	0	0
At_miR2118cOX_2	0	2,496,180	Separator	0	0	0	0
At_miROX_control	0	1,838,508	Separator	0	0	0	0
At_miROX_ck_2	0	1,804,409	Separator	0	0	0	0
hen1-8	2	5,456,831	Separator	1	1	2	4
hen1-8 ntp2-1	0	6,244,400	Separator	0	0	0	0
hen1-8 urt1-1	0	6,081,292	Separator	0	0	0	0
hen1-8 ntp4-1	1	4,626,878	Separator	1	1	1	2
hen1-8 ntp5-1	1	5,676,073	Separator	1	1	1	2
hen1-8 ntp6-1	2	4,328,718	Separator	1	1	2	5
hen1-8 ntp7-1	0	4,409,080	Separator	0	0	0	0
hen1-8 ntp8-1	0	8,736,008	Separator	0	0	0	0
hen1-8 ntp10-1	0	6,387,459	Separator	0	0	0	0
hen1-8 r2	0	2,874,203	Separator	0	0	0	0
hen1-8 heso1-1	0	6,015,054	Separator	0	0	0	0
hen1-8 mee44	0	3,435,030	Separator	0	0	0	0
Wt_d	0	7,517,450	Separator	0	0	0	0
Col_d	0	11,692,099	Separator	0	0	0	0

Link to FindMiRNA for this sequence