Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: AGAATCTTGATGATGCTGCAG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 2

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	3	c	3,599,811	Phasing window	AT3G11435	c	3,599,776	3,599,908	miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	3	c	3,599,811	Phasing window	ath-MIR172c	c	3,599,776	3,599,908	miRNA
3	3	w	20,587,991	Phasing window	AT3G55512	w	20,587,904	20,588,027	MIR172D; miRNA
4	3	w	20,587,991	Phasing window	ath-MIR172d	w	20,587,904	20,588,027	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	14,189	4,877,516	2,909	5,818	14,545	29,091
C0F2	55	2,789,465	20	39	99	197
d1F1	3,274	3,574,742	916	1,832	4,579	9,159
d1F2	182	3,705,660	49	98	246	491
d234F1	11,166	1,417,116	7,879	15,759	39,397	78,794
d234F2	2,479	3,822,319	649	1,297	3,243	6,486
r2F1	44,879	2,195,923	20,437	40,875	102,187	204,374
r2F2	8,567	2,233,522	3,836	7,671	19,178	38,356
r2FSb	100,046	5,728,276	17,465	34,931	87,326	174,653
r2FNaSb	40,524	5,311,047	7,630	15,260	38,151	76,301
r2FNa1	30,322	1,834,656	16,527	33,055	82,637	165,273
r2FNa2	28,797	6,081,068	4,736	9,471	23,678	47,355
r2FL	22,426	1,145,942	19,570	39,140	97,850	195,699
r2FD	44,336	4,928,142	8,996	17,993	44,982	89,965
C0FCSb	1,772	9,399,678	189	377	943	1,885
C0FSb	6,082	9,361,008	650	1,299	3,249	6,497
r2SC1	122	3,743,342	33	65	163	326
r2SH	1,263	2,165,395	583	1,167	2,916	5,833
r2SNa1	37	2,082,930	18	36	89	178
r2SC3	76	3,997,922	19	38	95	190
r2SNa2	167	4,617,795	36	72	181	362
r2SSb	155	3,278,680	47	95	236	473
r2SNaSb	137	3,087,212	44	89	222	444
r2SC2	6	476,105	13	25	63	126
r2SP	20	976,646	20	41	102	205
C0RC1	1,684	1,249,181	1,348	2,696	6,740	13,481
C0RNi	2,015	1,211,490	1,663	3,326	8,316	16,632
AtCM	41,387	14,488,208	2,857	5,713	14,283	28,566
AT_Leaf	0	8,047,907	0	0	0	0
At_miR1507OX_1	0	1,478,373	0	0	0	0
At_miR1507OX_2	0	1,638,916	0	0	0	0
At_miR2109OX_1	1	1,760,055	1	1	3	6
At_miR2109OX_2	0	2,446,954	0	0	0	0
At_miR2118aOX_1	0	1,212,493	0	0	0	0
At_miR2118aOX_2	0	1,258,140	0	0	0	0
At_miR2118bOX_1	0	2,023,619	0	0	0	0
At_miR2118bOX_2	0	1,733,586	0	0	0	0
At_miR2118cOX_1	1	1,995,522	1	1	3	5
At_miR2118cOX_2	1	2,496,180	1	1	2	4
At_miROX_control	0	1,838,508	0	0	0	0
At_miROX_ck_2	0	1,804,409	0	0	0	0
hen1-8	31	5,456,831	6	11	28	57
hen1-8 ntp2-1	33	6,244,400	5	11	26	53
hen1-8 urt1-1	39	6,081,292	6	13	32	64
hen1-8 ntp4-1	25	4,626,878	5	11	27	54
hen1-8 ntp5-1	49	5,676,073	9	17	43	86
hen1-8 ntp6-1	250	4,328,718	58	116	289	578
hen1-8 ntp7-1	20	4,409,080	5	9	23	45
hen1-8 ntp8-1	47	8,736,008	5	11	27	54
hen1-8 ntp10-1	31	6,387,459	5	10	24	49
hen1-8 r2	23	2,874,203	8	16	40	80
hen1-8 heso1-1	115	6,015,054	19	38	96	191
hen1-8 mee44	22	3,435,030	6	13	32	64
Wt_d	17,116	7,517,450	2,277	4,554	11,384	22,768
Col_d	113	11,692,099	10	19	48	97

Link to FindMiRNA for this sequence