Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: AGATATTGGTGCGGTTCAATC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	1	c	22,930,177	Phasing window	AT1G62035	c	22,930,089	22,930,204	MIR171C; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	1	c	22,930,177	Phasing window	ath-MIR171c	c	22,930,089	22,930,204	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	81	4,877,516	17	33	83	166
C0F2	1	2,789,465	1	1	2	4
d1F1	153	3,574,742	43	86	214	428
d1F2	67	3,705,660	18	36	90	181
d234F1	145	1,417,116	102	205	512	1,023
d234F2	196	3,822,319	51	103	256	513
r2F1	332	2,195,923	151	302	756	1,512
r2F2	447	2,233,522	200	400	1,001	2,001
r2FSb	801	5,728,276	140	280	699	1,398
r2FNaSb	764	5,311,047	144	288	719	1,439
r2FNa1	263	1,834,656	143	287	717	1,434
r2FNa2	1,396	6,081,068	230	459	1,148	2,296
r2FL	177	1,145,942	154	309	772	1,545
r2FD	749	4,928,142	152	304	760	1,520
C0FCSb	11	9,399,678	1	2	6	12
C0FSb	64	9,361,008	7	14	34	68
r2SC1	313	3,743,342	84	167	418	836
r2SH	856	2,165,395	395	791	1,977	3,953
r2SNa1	68	2,082,930	33	65	163	326
r2SC3	202	3,997,922	51	101	253	505
r2SNa2	322	4,617,795	70	139	349	697
r2SSb	639	3,278,680	195	390	974	1,949
r2SNaSb	203	3,087,212	66	132	329	658
r2SC2	36	476,105	76	151	378	756
r2SP	181	976,646	185	371	927	1,853
C0RC1	106	1,249,181	85	170	424	849
C0RNi	91	1,211,490	75	150	376	751
AtCM	0	14,488,208	0	0	0	0
AT_Leaf	15	8,047,907	2	4	9	19
At_miR1507OX_1	36	1,478,373	24	49	122	244
At_miR1507OX_2	27	1,638,916	16	33	82	165
At_miR2109OX_1	23	1,760,055	13	26	65	131
At_miR2109OX_2	42	2,446,954	17	34	86	172
At_miR2118aOX_1	21	1,212,493	17	35	87	173
At_miR2118aOX_2	25	1,258,140	20	40	99	199
At_miR2118bOX_1	32	2,023,619	16	32	79	158
At_miR2118bOX_2	16	1,733,586	9	18	46	92
At_miR2118cOX_1	50	1,995,522	25	50	125	251
At_miR2118cOX_2	38	2,496,180	15	30	76	152
At_miROX_control	27	1,838,508	15	29	73	147
At_miROX_ck_2	26	1,804,409	14	29	72	144
hen1-8	55	5,456,831	10	20	50	101
hen1-8 ntp2-1	55	6,244,400	9	18	44	88
hen1-8 urt1-1	57	6,081,292	9	19	47	94
hen1-8 ntp4-1	102	4,626,878	22	44	110	220
hen1-8 ntp5-1	108	5,676,073	19	38	95	190
hen1-8 ntp6-1	1,320	4,328,718	305	610	1,525	3,049
hen1-8 ntp7-1	67	4,409,080	15	30	76	152
hen1-8 ntp8-1	111	8,736,008	13	25	64	127
hen1-8 ntp10-1	43	6,387,459	7	13	34	67
hen1-8 r2	54	2,874,203	19	38	94	188
hen1-8 heso1-1	79	6,015,054	13	26	66	131
hen1-8 mee44	90	3,435,030	26	52	131	262
Wt_d	100	7,517,450	13	27	67	133
Col_d	115	11,692,099	10	20	49	98

Link to FindMiRNA for this sequence