Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: AGCTAAGGATTTGCATTCTCA
Length: 21 nucleotides
Number of hits: 2

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w18,686,859Phasing windowAT1G50440w18,685,77718,687,907RING/FYVE/PHD zinc finger superfamily protein

Other perfect matches found in genome in addition to that listed above.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21c18,686,962Phasing windowAT1G50440w18,685,77718,687,907RING/FYVE/PHD zinc finger superfamily protein




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F1674,877,516  142769137
C0F262,789,465  241122
d1F153,574,742  13714
d1F203,705,660  0000
d234F1481,417,116  3468169339
d234F2763,822,319  204099199
r2F13252,195,923  1482967401,480
r2F2892,233,522  4080199398
r2FSb6595,728,276  1152305751,150
r2FNaSb3135,311,047  59118295589
r2FNa11161,834,656  63126316632
r2FNa24086,081,068  67134335671
r2FL751,145,942  65131327654
r2FD3174,928,142  64129322643
C0FCSb169,399,678  23917
C0FSb629,361,008  7133366
r2SC11173,743,342  3163156313
r2SH2792,165,395  1292586441,288
r2SNa102,082,930  0000
r2SC31643,997,922  4182205410
r2SNa22714,617,795  59117293587
r2SSb2423,278,680  74148369738
r2SNaSb1583,087,212  51102256512
r2SC298476,105  2064121,0292,058
r2SP82976,646  84168420840
C0RC1851,249,181  68136340680
C0RNi721,211,490  59119297594
AtCM8214,488,208  6112857
AT_Leaf88,047,907  12510
At_miR1507OX_131,478,373  241020
At_miR1507OX_231,638,916  24918
At_miR2109OX_111,760,055  1136
At_miR2109OX_242,446,954  23816
At_miR2118aOX_121,212,493  23816
At_miR2118aOX_211,258,140  1248
At_miR2118bOX_172,023,619  371735
At_miR2118bOX_221,733,586  12612
At_miR2118cOX_121,995,522  12510
At_miR2118cOX_242,496,180  23816
At_miROX_control21,838,508  12511
At_miROX_ck_251,804,409  361428
hen1-815,456,831  1112
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-114,626,878  1112
hen1-8 ntp5-115,676,073  1112
hen1-8 ntp6-1134,328,718  361530
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-118,736,008  1111
hen1-8 ntp10-116,387,459  1112
hen1-8 r222,874,203  1137
hen1-8 heso1-126,015,054  1123
hen1-8 mee4413,435,030  1113
Wt_d2437,517,450  3265162323
Col_d311,692,099  1113


Link to FindMiRNA for this sequence