Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: AGGCTTTTAAGATCTGGTTGC
Length: 21 nucleotides
Number of hits: 15

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w14,363,105Phasing windowLink to IGR (7,313 bp)Small region at sequence (3 kb)

Other perfect matches found in genome in addition to that listed above.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21w14,408,758Phasing windowLink to IGR (7,399 bp)Small region at sequence (3 kb)
35w11,667,857Phasing windowLink to IGR (22,046 bp)Small region at sequence (3 kb)
45w11,669,275Phasing windowLink to IGR (22,046 bp)Small region at sequence (3 kb)
55w11,680,136Phasing windowLink to IGR (22,046 bp)Small region at sequence (3 kb)
65c11,737,130Phasing windowLink to IGR (17,713 bp)Small region at sequence (3 kb)
75c11,737,308Phasing windowLink to IGR (17,713 bp)Small region at sequence (3 kb)
85c11,757,162Phasing windowLink to IGR (13,522 bp)Small region at sequence (3 kb)
95c11,821,968Phasing windowLink to IGR (9,312 bp)Small region at sequence (3 kb)
105c11,961,212Phasing windowLink to IGR (32,190 bp)Small region at sequence (3 kb)
115c11,975,315Phasing windowLink to IGR (32,190 bp)Small region at sequence (3 kb)
125w12,025,940Phasing windowLink to IGR (6,555 bp)Small region at sequence (3 kb)
135c12,052,936Phasing windowLink to IGR (15,734 bp)Small region at sequence (3 kb)
145c12,053,646Phasing windowLink to IGR (15,734 bp)Small region at sequence (3 kb)
155c12,062,889Phasing windowLink to IGR (15,734 bp)Small region at sequence (3 kb)




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F1164,877,516  371633
C0F222,789,465  1147
d1F193,574,742  351325
d1F2263,705,660  7143570
d234F1121,417,116  8174285
d234F21513,822,319  4079198395
r2F102,195,923  0000
r2F202,233,522  0000
r2FSb05,728,276  0000
r2FNaSb05,311,047  0000
r2FNa101,834,656  0000
r2FNa206,081,068  0000
r2FL01,145,942  0000
r2FD04,928,142  0000
C0FCSb59,399,678  1135
C0FSb279,361,008  361429
r2SC103,743,342  0000
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC303,997,922  0000
r2SNa204,617,795  0000
r2SSb13,278,680  1123
r2SNaSb03,087,212  0000
r2SC20476,105  0000
r2SP0976,646  0000
C0RC1291,249,181  2346116232
C0RNi71,211,490  6122958
AtCM2014,488,208  13714
AT_Leaf98,047,907  12611
At_miR1507OX_111,478,373  1137
At_miR1507OX_211,638,916  1136
At_miR2109OX_111,760,055  1136
At_miR2109OX_202,446,954  0000
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_211,258,140  1248
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_201,733,586  0000
At_miR2118cOX_111,995,522  1135
At_miR2118cOX_212,496,180  1124
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-8115,456,831  241020
hen1-8 ntp2-1156,244,400  251224
hen1-8 urt1-196,081,292  13715
hen1-8 ntp4-174,626,878  23815
hen1-8 ntp5-175,676,073  12612
hen1-8 ntp6-114,328,718  1112
hen1-8 ntp7-194,409,080  241020
hen1-8 ntp8-1148,736,008  23816
hen1-8 ntp10-1146,387,459  241122
hen1-8 r212,874,203  1123
hen1-8 heso1-146,015,054  1137
hen1-8 mee4433,435,030  1249
Wt_d177,517,450  251123
Col_d411,692,099  1123


Link to FindMiRNA for this sequence