Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: AGGGTTGATATGAGAACACAC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 2

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15w4,691,033Phasing windowAT5G14545w4,691,0224,691,137MIR398B; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
25w4,691,033Phasing windowAT5G14550c4,691,0064,694,055Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein
35w4,691,033Phasing windowath-MIR398bw4,691,0224,691,137miRNA
45w4,694,705Phasing windowAT5G14565w4,694,6264,697,013MIR398C; miRNA
55w4,694,705Phasing windowath-MIR398cw4,694,6944,694,808miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F111,417,116  1147
d234F2153,822,319  482039
r2F152,195,923  251123
r2F282,233,522  471836
r2FSb25,728,276  1123
r2FNaSb35,311,047  1136
r2FNa1131,834,656  7143571
r2FNa206,081,068  0000
r2FL131,145,942  112357113
r2FD374,928,142  8153875
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC1213,743,342  6112856
r2SH142,165,395  6133265
r2SNa102,082,930  0000
r2SC313,997,922  1113
r2SNa284,617,795  23917
r2SSb23,278,680  1136
r2SNaSb63,087,212  241019
r2SC21476,105  241121
r2SP3976,646  361531
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM314,488,208  1112
AT_Leaf1,4168,047,907  1763528801,759
At_miR1507OX_11171,478,373  79158396791
At_miR1507OX_2321,638,916  203998195
At_miR2109OX_1281,760,055  163280159
At_miR2109OX_2992,446,954  4081202405
At_miR2118aOX_1261,212,493  2143107214
At_miR2118aOX_2801,258,140  64127318636
At_miR2118bOX_1562,023,619  2855138277
At_miR2118bOX_2381,733,586  2244110219
At_miR2118cOX_1861,995,522  4386215431
At_miR2118cOX_21232,496,180  4999246493
At_miROX_control91,838,508  5102449
At_miROX_ck_2131,804,409  7143672
hen1-8235,456,831  482142
hen1-8 ntp2-1566,244,400  9184590
hen1-8 urt1-1426,081,292  7143569
hen1-8 ntp4-1564,626,878  122461121
hen1-8 ntp5-11375,676,073  2448121241
hen1-8 ntp6-14314,328,718  100199498996
hen1-8 ntp7-1344,409,080  8153977
hen1-8 ntp8-1568,736,008  6133264
hen1-8 ntp10-1786,387,459  122461122
hen1-8 r2222,874,203  8153877
hen1-8 heso1-1256,015,054  482142
hen1-8 mee44243,435,030  7143570
Wt_d07,517,450  0000
Col_d111,692,099  1111


Link to FindMiRNA for this sequence