Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: ATAAATCCCAACATCTTCCA
Length: 20 nucleotides
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w11,786,294Phasing windowAT1G32583w11,785,80611,788,286




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F213,822,319  1113
r2F102,195,923  0000
r2F202,233,522  0000
r2FSb05,728,276  0000
r2FNaSb05,311,047  0000
r2FNa111,834,656  1135
r2FNa236,081,068  1125
r2FL11,145,942  1249
r2FD24,928,142  1124
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC123,743,342  1135
r2SH112,165,395  5102551
r2SNa102,082,930  0000
r2SC343,997,922  12510
r2SNa2104,617,795  241122
r2SSb123,278,680  471837
r2SNaSb103,087,212  361632
r2SC20476,105  0000
r2SP0976,646  0000
C0RC111,249,181  1248
C0RNi01,211,490  0000
AtCM014,488,208  0000
AT_Leaf258,047,907  361631
At_miR1507OX_151,478,373  371734
At_miR1507OX_271,638,916  492143
At_miR2109OX_121,760,055  12611
At_miR2109OX_292,446,954  471837
At_miR2118aOX_121,212,493  23816
At_miR2118aOX_241,258,140  361632
At_miR2118bOX_162,023,619  361530
At_miR2118bOX_231,733,586  23917
At_miR2118cOX_181,995,522  482040
At_miR2118cOX_272,496,180  361428
At_miROX_control61,838,508  371633
At_miROX_ck_211,804,409  1136
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-106,081,292  0000
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d07,517,450  0000
Col_d011,692,099  0000


Link to FindMiRNA for this sequence