Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: ATCAGTTTCTTGTTCGTTTCA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 2

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w6,520,995Phasing windowAT1G18879w6,520,9416,521,124MIR837a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21w6,520,995Phasing windowAT1G18880w6,520,7486,523,368Major facilitator superfamily protein
31w6,520,995Phasing windowath-MIR837w6,520,9416,521,124miRNA
41c6,521,334Phasing windowAT1G18880w6,520,7486,523,368Major facilitator superfamily protein




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F223,822,319  1135
r2F102,195,923  0000
r2F222,233,522  1249
r2FSb25,728,276  1123
r2FNaSb25,311,047  1124
r2FNa101,834,656  0000
r2FNa256,081,068  1248
r2FL01,145,942  0000
r2FD14,928,142  1112
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC163,743,342  23816
r2SH62,165,395  361428
r2SNa102,082,930  0000
r2SC343,997,922  12510
r2SNa224,617,795  1124
r2SSb83,278,680  251224
r2SNaSb33,087,212  12510
r2SC27476,105  152974147
r2SP9976,646  9184692
C0RC12091,249,181  1673358371,673
C0RNi581,211,490  4896239479
AtCM014,488,208  0000
AT_Leaf228,047,907  351427
At_miR1507OX_111,478,373  1137
At_miR1507OX_211,638,916  1136
At_miR2109OX_101,760,055  0000
At_miR2109OX_212,446,954  1124
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_112,023,619  1125
At_miR2118bOX_211,733,586  1136
At_miR2118cOX_111,995,522  1135
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-116,081,292  1112
hen1-8 ntp4-104,626,878  0000
hen1-8 ntp5-105,676,073  0000
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d17,517,450  1111
Col_d011,692,099  0000


Link to FindMiRNA for this sequence