Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: ATCATGCGATCTCTTTGGATT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	3	w	20,691,778	Phasing window	AT3G55734	w	20,691,647	20,691,806	MIR393B; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	3	w	20,691,778	Phasing window	ath-MIR393b	w	20,691,647	20,691,806	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	40	4,877,516	8	16	41	82
C0F2	18	2,789,465	6	13	32	65
d1F1	2	3,574,742	1	1	3	6
d1F2	5	3,705,660	1	3	7	13
d234F1	65	1,417,116	46	92	229	459
d234F2	388	3,822,319	102	203	508	1,015
r2F1	171	2,195,923	78	156	389	779
r2F2	1,713	2,233,522	767	1,534	3,835	7,670
r2FSb	1,244	5,728,276	217	434	1,086	2,172
r2FNaSb	2,389	5,311,047	450	900	2,249	4,498
r2FNa1	402	1,834,656	219	438	1,096	2,191
r2FNa2	3,018	6,081,068	496	993	2,481	4,963
r2FL	480	1,145,942	419	838	2,094	4,189
r2FD	1,488	4,928,142	302	604	1,510	3,019
C0FCSb	7	9,399,678	1	1	4	7
C0FSb	27	9,361,008	3	6	14	29
r2SC1	119	3,743,342	32	64	159	318
r2SH	68	2,165,395	31	63	157	314
r2SNa1	61	2,082,930	29	59	146	293
r2SC3	508	3,997,922	127	254	635	1,271
r2SNa2	319	4,617,795	69	138	345	691
r2SSb	438	3,278,680	134	267	668	1,336
r2SNaSb	297	3,087,212	96	192	481	962
r2SC2	388	476,105	815	1,630	4,075	8,149
r2SP	157	976,646	161	322	804	1,608
C0RC1	108	1,249,181	86	173	432	865
C0RNi	78	1,211,490	64	129	322	644
AtCM	8	14,488,208	1	1	3	6
AT_Leaf	13,720	8,047,907	1,705	3,410	8,524	17,048
At_miR1507OX_1	2,174	1,478,373	1,471	2,941	7,353	14,705
At_miR1507OX_2	1,508	1,638,916	920	1,840	4,601	9,201
At_miR2109OX_1	894	1,760,055	508	1,016	2,540	5,079
At_miR2109OX_2	2,094	2,446,954	856	1,712	4,279	8,558
At_miR2118aOX_1	868	1,212,493	716	1,432	3,579	7,159
At_miR2118aOX_2	1,212	1,258,140	963	1,927	4,817	9,633
At_miR2118bOX_1	1,422	2,023,619	703	1,405	3,514	7,027
At_miR2118bOX_2	951	1,733,586	549	1,097	2,743	5,486
At_miR2118cOX_1	2,009	1,995,522	1,007	2,014	5,034	10,068
At_miR2118cOX_2	1,790	2,496,180	717	1,434	3,585	7,171
At_miROX_control	1,758	1,838,508	956	1,912	4,781	9,562
At_miROX_ck_2	1,183	1,804,409	656	1,311	3,278	6,556
hen1-8	1,124	5,456,831	206	412	1,030	2,060
hen1-8 ntp2-1	1,017	6,244,400	163	326	814	1,629
hen1-8 urt1-1	1,804	6,081,292	297	593	1,483	2,966
hen1-8 ntp4-1	1,088	4,626,878	235	470	1,176	2,351
hen1-8 ntp5-1	2,714	5,676,073	478	956	2,391	4,781
hen1-8 ntp6-1	17,575	4,328,718	4,060	8,120	20,300	40,601
hen1-8 ntp7-1	1,070	4,409,080	243	485	1,213	2,427
hen1-8 ntp8-1	2,632	8,736,008	301	603	1,506	3,013
hen1-8 ntp10-1	1,523	6,387,459	238	477	1,192	2,384
hen1-8 r2	559	2,874,203	194	389	972	1,945
hen1-8 heso1-1	1,680	6,015,054	279	559	1,396	2,793
hen1-8 mee44	1,186	3,435,030	345	691	1,726	3,453
Wt_d	190	7,517,450	25	51	126	253
Col_d	1,587	11,692,099	136	271	679	1,357

Link to FindMiRNA for this sequence