Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: ATCATGCTATCTCTTTGGATT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	w	16,652,205	Phasing window	AT2G39885	w	16,652,101	16,652,233	miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	w	16,652,205	Phasing window	ath-MIR393a	w	16,652,101	16,652,233	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	1	4,877,516	1	1	1	2
C0F2	1	2,789,465	1	1	2	4
d1F1	1	3,574,742	1	1	1	3
d1F2	0	3,705,660	0	0	0	0
d234F1	3	1,417,116	2	4	11	21
d234F2	7	3,822,319	2	4	9	18
r2F1	4	2,195,923	2	4	9	18
r2F2	48	2,233,522	21	43	107	215
r2FSb	24	5,728,276	4	8	21	42
r2FNaSb	18	5,311,047	3	7	17	34
r2FNa1	3	1,834,656	2	3	8	16
r2FNa2	50	6,081,068	8	16	41	82
r2FL	6	1,145,942	5	10	26	52
r2FD	19	4,928,142	4	8	19	39
C0FCSb	2	9,399,678	1	1	1	2
C0FSb	0	9,361,008	0	0	0	0
r2SC1	14	3,743,342	4	7	19	37
r2SH	16	2,165,395	7	15	37	74
r2SNa1	11	2,082,930	5	11	26	53
r2SC3	25	3,997,922	6	13	31	63
r2SNa2	15	4,617,795	3	6	16	32
r2SSb	40	3,278,680	12	24	61	122
r2SNaSb	17	3,087,212	6	11	28	55
r2SC2	14	476,105	29	59	147	294
r2SP	14	976,646	14	29	72	143
C0RC1	45	1,249,181	36	72	180	360
C0RNi	35	1,211,490	29	58	144	289
AtCM	0	14,488,208	0	0	0	0
AT_Leaf	494	8,047,907	61	123	307	614
At_miR1507OX_1	148	1,478,373	100	200	501	1,001
At_miR1507OX_2	127	1,638,916	77	155	387	775
At_miR2109OX_1	36	1,760,055	20	41	102	205
At_miR2109OX_2	175	2,446,954	72	143	358	715
At_miR2118aOX_1	58	1,212,493	48	96	239	478
At_miR2118aOX_2	86	1,258,140	68	137	342	684
At_miR2118bOX_1	93	2,023,619	46	92	230	460
At_miR2118bOX_2	55	1,733,586	32	63	159	317
At_miR2118cOX_1	218	1,995,522	109	218	546	1,092
At_miR2118cOX_2	142	2,496,180	57	114	284	569
At_miROX_control	108	1,838,508	59	117	294	587
At_miROX_ck_2	59	1,804,409	33	65	163	327
hen1-8	28	5,456,831	5	10	26	51
hen1-8 ntp2-1	41	6,244,400	7	13	33	66
hen1-8 urt1-1	36	6,081,292	6	12	30	59
hen1-8 ntp4-1	21	4,626,878	5	9	23	45
hen1-8 ntp5-1	75	5,676,073	13	26	66	132
hen1-8 ntp6-1	378	4,328,718	87	175	437	873
hen1-8 ntp7-1	32	4,409,080	7	15	36	73
hen1-8 ntp8-1	60	8,736,008	7	14	34	69
hen1-8 ntp10-1	38	6,387,459	6	12	30	59
hen1-8 r2	16	2,874,203	6	11	28	56
hen1-8 heso1-1	28	6,015,054	5	9	23	47
hen1-8 mee44	29	3,435,030	8	17	42	84
Wt_d	5	7,517,450	1	1	3	7
Col_d	15	11,692,099	1	3	6	13

Link to FindMiRNA for this sequence