Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: ATCCTCGGGATACAGTTTACC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	5	w	400,464	Phasing window	AT5G02035	w	400,383	400,502

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	5	w	400,464	Phasing window	ath-MIR2111b	w	400,358	400,524	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	1	4,877,516	1	1	1	2
C0F2	4	2,789,465	1	3	7	14
d1F1	0	3,574,742	0	0	0	0
d1F2	0	3,705,660	0	0	0	0
d234F1	8	1,417,116	6	11	28	56
d234F2	40	3,822,319	10	21	52	105
r2F1	28	2,195,923	13	26	64	128
r2F2	77	2,233,522	34	69	172	345
r2FSb	164	5,728,276	29	57	143	286
r2FNaSb	168	5,311,047	32	63	158	316
r2FNa1	12	1,834,656	7	13	33	65
r2FNa2	314	6,081,068	52	103	258	516
r2FL	6	1,145,942	5	10	26	52
r2FD	281	4,928,142	57	114	285	570
C0FCSb	0	9,399,678	0	0	0	0
C0FSb	2	9,361,008	1	1	1	2
r2SC1	79	3,743,342	21	42	106	211
r2SH	60	2,165,395	28	55	139	277
r2SNa1	22	2,082,930	11	21	53	106
r2SC3	95	3,997,922	24	48	119	238
r2SNa2	100	4,617,795	22	43	108	217
r2SSb	352	3,278,680	107	215	537	1,074
r2SNaSb	103	3,087,212	33	67	167	334
r2SC2	29	476,105	61	122	305	609
r2SP	666	976,646	682	1,364	3,410	6,819
C0RC1	30	1,249,181	24	48	120	240
C0RNi	7	1,211,490	6	12	29	58
AtCM	0	14,488,208	0	0	0	0
AT_Leaf	2	8,047,907	1	1	1	2
At_miR1507OX_1	0	1,478,373	0	0	0	0
At_miR1507OX_2	0	1,638,916	0	0	0	0
At_miR2109OX_1	0	1,760,055	0	0	0	0
At_miR2109OX_2	1	2,446,954	1	1	2	4
At_miR2118aOX_1	1	1,212,493	1	2	4	8
At_miR2118aOX_2	0	1,258,140	0	0	0	0
At_miR2118bOX_1	0	2,023,619	0	0	0	0
At_miR2118bOX_2	0	1,733,586	0	0	0	0
At_miR2118cOX_1	1	1,995,522	1	1	3	5
At_miR2118cOX_2	0	2,496,180	0	0	0	0
At_miROX_control	1	1,838,508	1	1	3	5
At_miROX_ck_2	0	1,804,409	0	0	0	0
hen1-8	0	5,456,831	0	0	0	0
hen1-8 ntp2-1	0	6,244,400	0	0	0	0
hen1-8 urt1-1	0	6,081,292	0	0	0	0
hen1-8 ntp4-1	0	4,626,878	0	0	0	0
hen1-8 ntp5-1	0	5,676,073	0	0	0	0
hen1-8 ntp6-1	11	4,328,718	3	5	13	25
hen1-8 ntp7-1	0	4,409,080	0	0	0	0
hen1-8 ntp8-1	4	8,736,008	1	1	2	5
hen1-8 ntp10-1	0	6,387,459	0	0	0	0
hen1-8 r2	2	2,874,203	1	1	3	7
hen1-8 heso1-1	1	6,015,054	1	1	1	2
hen1-8 mee44	0	3,435,030	0	0	0	0
Wt_d	28	7,517,450	4	7	19	37
Col_d	3	11,692,099	1	1	1	3

Link to FindMiRNA for this sequence