Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: ATGAGTTGGGTCTAACCCATAACT
Length: 24 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 4

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	c	9,635,024	Phasing window	AT2G22668	c	9,634,957	9,635,113	MIR405A; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	c	9,635,024	Phasing window	ath-MIR405a	c	9,634,957	9,635,113	miRNA
3	4	c	2,789,693	Phasing window	AT4G05508	c	2,789,656	2,789,741	MIR405D; miRNA
4	4	c	2,789,693	Phasing window	ath-MIR405d	c	2,789,656	2,789,741	miRNA
5	5	c	20,632,574	Phasing window	AT5G50717	w	20,632,514	20,632,637	MIR405B; miRNA
6	5	c	20,632,574	Phasing window	ath-MIR405b	w	20,632,514	20,632,637	miRNA
7	5	w	20,632,583	Phasing window	AT5G50717	w	20,632,514	20,632,637	MIR405B; miRNA
8	5	w	20,632,583	Phasing window	ath-MIR405b	w	20,632,514	20,632,637	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	0	4,877,516	0	0	0	0
C0F2	0	2,789,465	0	0	0	0
d1F1	1	3,574,742	1	1	1	3
d1F2	1	3,705,660	1	1	1	3
d234F1	0	1,417,116	0	0	0	0
d234F2	0	3,822,319	0	0	0	0
r2F1	0	2,195,923	0	0	0	0
r2F2	0	2,233,522	0	0	0	0
r2FSb	0	5,728,276	0	0	0	0
r2FNaSb	0	5,311,047	0	0	0	0
r2FNa1	0	1,834,656	0	0	0	0
r2FNa2	0	6,081,068	0	0	0	0
r2FL	0	1,145,942	0	0	0	0
r2FD	0	4,928,142	0	0	0	0
C0FCSb	0	9,399,678	0	0	0	0
C0FSb	0	9,361,008	0	0	0	0
r2SC1	0	3,743,342	0	0	0	0
r2SH	0	2,165,395	0	0	0	0
r2SNa1	0	2,082,930	0	0	0	0
r2SC3	0	3,997,922	0	0	0	0
r2SNa2	0	4,617,795	0	0	0	0
r2SSb	0	3,278,680	0	0	0	0
r2SNaSb	0	3,087,212	0	0	0	0
r2SC2	0	476,105	0	0	0	0
r2SP	0	976,646	0	0	0	0
C0RC1	0	1,249,181	0	0	0	0
C0RNi	0	1,211,490	0	0	0	0
AtCM	0	14,488,208	0	0	0	0
AT_Leaf	0	8,047,907	0	0	0	0
At_miR1507OX_1	0	1,478,373	0	0	0	0
At_miR1507OX_2	0	1,638,916	0	0	0	0
At_miR2109OX_1	0	1,760,055	0	0	0	0
At_miR2109OX_2	0	2,446,954	0	0	0	0
At_miR2118aOX_1	0	1,212,493	0	0	0	0
At_miR2118aOX_2	0	1,258,140	0	0	0	0
At_miR2118bOX_1	0	2,023,619	0	0	0	0
At_miR2118bOX_2	0	1,733,586	0	0	0	0
At_miR2118cOX_1	0	1,995,522	0	0	0	0
At_miR2118cOX_2	0	2,496,180	0	0	0	0
At_miROX_control	0	1,838,508	0	0	0	0
At_miROX_ck_2	0	1,804,409	0	0	0	0
hen1-8	0	5,456,831	0	0	0	0
hen1-8 ntp2-1	0	6,244,400	0	0	0	0
hen1-8 urt1-1	0	6,081,292	0	0	0	0
hen1-8 ntp4-1	0	4,626,878	0	0	0	0
hen1-8 ntp5-1	0	5,676,073	0	0	0	0
hen1-8 ntp6-1	0	4,328,718	0	0	0	0
hen1-8 ntp7-1	0	4,409,080	0	0	0	0
hen1-8 ntp8-1	0	8,736,008	0	0	0	0
hen1-8 ntp10-1	0	6,387,459	0	0	0	0
hen1-8 r2	0	2,874,203	0	0	0	0
hen1-8 heso1-1	0	6,015,054	0	0	0	0
hen1-8 mee44	0	3,435,030	0	0	0	0
Wt_d	0	7,517,450	0	0	0	0
Col_d	1	11,692,099	1	1	1	1

Link to FindMiRNA for this sequence