Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: ATGCACTGCCTCTTCCCTGGC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	w	19,319,933	Phasing window	AT2G47015	w	19,319,780	19,321,026	miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	w	19,319,933	Phasing window	AT2G47020	c	19,319,685	19,322,391	unknown function
3	2	w	19,319,933	Phasing window	ath-MIR408	w	19,319,814	19,320,031	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	1	4,877,516	1	1	1	2
C0F2	0	2,789,465	0	0	0	0
d1F1	31	3,574,742	9	17	43	87
d1F2	5	3,705,660	1	3	7	13
d234F1	103	1,417,116	73	145	363	727
d234F2	1,682	3,822,319	440	880	2,200	4,400
r2F1	24	2,195,923	11	22	55	109
r2F2	555	2,233,522	248	497	1,242	2,485
r2FSb	105	5,728,276	18	37	92	183
r2FNaSb	284	5,311,047	53	107	267	535
r2FNa1	94	1,834,656	51	102	256	512
r2FNa2	50	6,081,068	8	16	41	82
r2FL	44	1,145,942	38	77	192	384
r2FD	1,989	4,928,142	404	807	2,018	4,036
C0FCSb	0	9,399,678	0	0	0	0
C0FSb	12	9,361,008	1	3	6	13
r2SC1	410	3,743,342	110	219	548	1,095
r2SH	1,068	2,165,395	493	986	2,466	4,932
r2SNa1	67	2,082,930	32	64	161	322
r2SC3	66	3,997,922	17	33	83	165
r2SNa2	113	4,617,795	24	49	122	245
r2SSb	489	3,278,680	149	298	746	1,491
r2SNaSb	100	3,087,212	32	65	162	324
r2SC2	240	476,105	504	1,008	2,520	5,041
r2SP	1,270	976,646	1,300	2,601	6,502	13,004
C0RC1	5	1,249,181	4	8	20	40
C0RNi	1	1,211,490	1	2	4	8
AtCM	7	14,488,208	1	1	2	5
AT_Leaf	432	8,047,907	54	107	268	537
At_miR1507OX_1	268	1,478,373	181	363	906	1,813
At_miR1507OX_2	104	1,638,916	63	127	317	635
At_miR2109OX_1	118	1,760,055	67	134	335	670
At_miR2109OX_2	435	2,446,954	178	356	889	1,778
At_miR2118aOX_1	139	1,212,493	115	229	573	1,146
At_miR2118aOX_2	249	1,258,140	198	396	990	1,979
At_miR2118bOX_1	197	2,023,619	97	195	487	974
At_miR2118bOX_2	113	1,733,586	65	130	326	652
At_miR2118cOX_1	295	1,995,522	148	296	739	1,478
At_miR2118cOX_2	360	2,496,180	144	288	721	1,442
At_miROX_control	81	1,838,508	44	88	220	441
At_miROX_ck_2	67	1,804,409	37	74	186	371
hen1-8	85	5,456,831	16	31	78	156
hen1-8 ntp2-1	186	6,244,400	30	60	149	298
hen1-8 urt1-1	77	6,081,292	13	25	63	127
hen1-8 ntp4-1	130	4,626,878	28	56	140	281
hen1-8 ntp5-1	280	5,676,073	49	99	247	493
hen1-8 ntp6-1	1,326	4,328,718	306	613	1,532	3,063
hen1-8 ntp7-1	83	4,409,080	19	38	94	188
hen1-8 ntp8-1	182	8,736,008	21	42	104	208
hen1-8 ntp10-1	194	6,387,459	30	61	152	304
hen1-8 r2	91	2,874,203	32	63	158	317
hen1-8 heso1-1	186	6,015,054	31	62	155	309
hen1-8 mee44	145	3,435,030	42	84	211	422
Wt_d	49	7,517,450	7	13	33	65
Col_d	132	11,692,099	11	23	56	113

Link to FindMiRNA for this sequence