Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: CACGTGTTCTACTACTCCAAC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15w9,852,747Phasing windowAT5G27807w9,852,6649,852,783MIR164/MIR164C; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
25w9,852,747Phasing windowath-MIR164cw9,852,6749,852,775miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F111,417,116  1147
d234F213,822,319  1113
r2F112,195,923  1125
r2F212,233,522  1124
r2FSb295,728,276  5102551
r2FNaSb305,311,047  6112856
r2FNa111,834,656  1135
r2FNa2336,081,068  5112754
r2FL01,145,942  0000
r2FD294,928,142  6122959
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC163,743,342  23816
r2SH02,165,395  0000
r2SNa112,082,930  1125
r2SC373,997,922  24918
r2SNa2104,617,795  241122
r2SSb153,278,680  592346
r2SNaSb153,087,212  5102449
r2SC27476,105  152974147
r2SP0976,646  0000
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM1114,488,208  1248
AT_Leaf118,047,907  13714
At_miR1507OX_1111,478,373  7153774
At_miR1507OX_271,638,916  492143
At_miR2109OX_121,760,055  12611
At_miR2109OX_2122,446,954  5102549
At_miR2118aOX_121,212,493  23816
At_miR2118aOX_211,258,140  1248
At_miR2118bOX_172,023,619  371735
At_miR2118bOX_221,733,586  12612
At_miR2118cOX_181,995,522  482040
At_miR2118cOX_252,496,180  241020
At_miROX_control41,838,508  241122
At_miROX_ck_201,804,409  0000
hen1-875,456,831  13613
hen1-8 ntp2-156,244,400  1248
hen1-8 urt1-146,081,292  1137
hen1-8 ntp4-1114,626,878  251224
hen1-8 ntp5-1145,676,073  251225
hen1-8 ntp6-1744,328,718  173485171
hen1-8 ntp7-174,409,080  23816
hen1-8 ntp8-198,736,008  12510
hen1-8 ntp10-1106,387,459  23816
hen1-8 r242,874,203  13714
hen1-8 heso1-136,015,054  1125
hen1-8 mee4453,435,030  13715
Wt_d187,517,450  251224
Col_d411,692,099  1123


Link to FindMiRNA for this sequence