Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: CAGCCAAGGATGACTTGCCGA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	3	c	4,359,202	Phasing window	AT3G13405	c	4,359,012	4,359,202	miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	3	c	4,359,202	Phasing window	ath-MIR169a	c	4,358,994	4,359,219	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	562	4,877,516	115	230	576	1,152
C0F2	1	2,789,465	1	1	2	4
d1F1	28	3,574,742	8	16	39	78
d1F2	3	3,705,660	1	2	4	8
d234F1	872	1,417,116	615	1,231	3,077	6,153
d234F2	266	3,822,319	70	139	348	696
r2F1	2,729	2,195,923	1,243	2,486	6,214	12,428
r2F2	669	2,233,522	300	599	1,498	2,995
r2FSb	1,649	5,728,276	288	576	1,439	2,879
r2FNaSb	2,064	5,311,047	389	777	1,943	3,886
r2FNa1	4,907	1,834,656	2,675	5,349	13,373	26,746
r2FNa2	1,034	6,081,068	170	340	850	1,700
r2FL	1,172	1,145,942	1,023	2,045	5,114	10,227
r2FD	4,912	4,928,142	997	1,993	4,984	9,967
C0FCSb	119	9,399,678	13	25	63	127
C0FSb	389	9,361,008	42	83	208	416
r2SC1	993	3,743,342	265	531	1,326	2,653
r2SH	6,409	2,165,395	2,960	5,919	14,799	29,597
r2SNa1	198	2,082,930	95	190	475	951
r2SC3	1,282	3,997,922	321	641	1,603	3,207
r2SNa2	3,560	4,617,795	771	1,542	3,855	7,709
r2SSb	2,585	3,278,680	788	1,577	3,942	7,884
r2SNaSb	3,349	3,087,212	1,085	2,170	5,424	10,848
r2SC2	214	476,105	449	899	2,247	4,495
r2SP	255	976,646	261	522	1,305	2,611
C0RC1	1,839	1,249,181	1,472	2,944	7,361	14,722
C0RNi	1,475	1,211,490	1,218	2,435	6,088	12,175
AtCM	42,823	14,488,208	2,956	5,911	14,779	29,557
AT_Leaf	2,275	8,047,907	283	565	1,413	2,827
At_miR1507OX_1	52	1,478,373	35	70	176	352
At_miR1507OX_2	92	1,638,916	56	112	281	561
At_miR2109OX_1	82	1,760,055	47	93	233	466
At_miR2109OX_2	86	2,446,954	35	70	176	351
At_miR2118aOX_1	33	1,212,493	27	54	136	272
At_miR2118aOX_2	66	1,258,140	52	105	262	525
At_miR2118bOX_1	92	2,023,619	45	91	227	455
At_miR2118bOX_2	65	1,733,586	37	75	187	375
At_miR2118cOX_1	95	1,995,522	48	95	238	476
At_miR2118cOX_2	61	2,496,180	24	49	122	244
At_miROX_control	30	1,838,508	16	33	82	163
At_miROX_ck_2	43	1,804,409	24	48	119	238
hen1-8	3	5,456,831	1	1	3	5
hen1-8 ntp2-1	2	6,244,400	1	1	2	3
hen1-8 urt1-1	2	6,081,292	1	1	2	3
hen1-8 ntp4-1	1	4,626,878	1	1	1	2
hen1-8 ntp5-1	2	5,676,073	1	1	2	4
hen1-8 ntp6-1	6	4,328,718	1	3	7	14
hen1-8 ntp7-1	1	4,409,080	1	1	1	2
hen1-8 ntp8-1	3	8,736,008	1	1	2	3
hen1-8 ntp10-1	1	6,387,459	1	1	1	2
hen1-8 r2	0	2,874,203	0	0	0	0
hen1-8 heso1-1	1	6,015,054	1	1	1	2
hen1-8 mee44	1	3,435,030	1	1	1	3
Wt_d	3,249	7,517,450	432	864	2,161	4,322
Col_d	10	11,692,099	1	2	4	9

Link to FindMiRNA for this sequence