Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: CAGCCAAGGATGACTTGCCGG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 2

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	5	w	8,527,511	Phasing window	AT5G24825	w	8,527,469	8,527,649	MIR169B; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	5	w	8,527,511	Phasing window	ath-MIR169b	w	8,527,469	8,527,649	miRNA
3	5	c	15,870,888	Phasing window	AT5G39635	c	15,870,590	15,871,000	MIR169C; miRNA
4	5	c	15,870,888	Phasing window	ath-MIR169c	c	15,870,590	15,871,000	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	41	4,877,516	8	17	42	84
C0F2	0	2,789,465	0	0	0	0
d1F1	5	3,574,742	1	3	7	14
d1F2	2	3,705,660	1	1	3	5
d234F1	148	1,417,116	104	209	522	1,044
d234F2	43	3,822,319	11	22	56	112
r2F1	148	2,195,923	67	135	337	674
r2F2	41	2,233,522	18	37	92	184
r2FSb	812	5,728,276	142	284	709	1,418
r2FNaSb	446	5,311,047	84	168	420	840
r2FNa1	216	1,834,656	118	235	589	1,177
r2FNa2	319	6,081,068	52	105	262	525
r2FL	74	1,145,942	65	129	323	646
r2FD	303	4,928,142	61	123	307	615
C0FCSb	10	9,399,678	1	2	5	11
C0FSb	79	9,361,008	8	17	42	84
r2SC1	176	3,743,342	47	94	235	470
r2SH	570	2,165,395	263	526	1,316	2,632
r2SNa1	9	2,082,930	4	9	22	43
r2SC3	67	3,997,922	17	34	84	168
r2SNa2	342	4,617,795	74	148	370	741
r2SSb	232	3,278,680	71	142	354	708
r2SNaSb	143	3,087,212	46	93	232	463
r2SC2	7	476,105	15	29	74	147
r2SP	8	976,646	8	16	41	82
C0RC1	85	1,249,181	68	136	340	680
C0RNi	116	1,211,490	96	191	479	957
AtCM	1,101	14,488,208	76	152	380	760
AT_Leaf	8,009	8,047,907	995	1,990	4,976	9,952
At_miR1507OX_1	0	1,478,373	0	0	0	0
At_miR1507OX_2	0	1,638,916	0	0	0	0
At_miR2109OX_1	0	1,760,055	0	0	0	0
At_miR2109OX_2	1	2,446,954	1	1	2	4
At_miR2118aOX_1	0	1,212,493	0	0	0	0
At_miR2118aOX_2	0	1,258,140	0	0	0	0
At_miR2118bOX_1	1	2,023,619	1	1	2	5
At_miR2118bOX_2	0	1,733,586	0	0	0	0
At_miR2118cOX_1	0	1,995,522	0	0	0	0
At_miR2118cOX_2	0	2,496,180	0	0	0	0
At_miROX_control	0	1,838,508	0	0	0	0
At_miROX_ck_2	0	1,804,409	0	0	0	0
hen1-8	0	5,456,831	0	0	0	0
hen1-8 ntp2-1	1	6,244,400	1	1	1	2
hen1-8 urt1-1	0	6,081,292	0	0	0	0
hen1-8 ntp4-1	1	4,626,878	1	1	1	2
hen1-8 ntp5-1	0	5,676,073	0	0	0	0
hen1-8 ntp6-1	3	4,328,718	1	1	3	7
hen1-8 ntp7-1	0	4,409,080	0	0	0	0
hen1-8 ntp8-1	3	8,736,008	1	1	2	3
hen1-8 ntp10-1	0	6,387,459	0	0	0	0
hen1-8 r2	0	2,874,203	0	0	0	0
hen1-8 heso1-1	1	6,015,054	1	1	1	2
hen1-8 mee44	0	3,435,030	0	0	0	0
Wt_d	141	7,517,450	19	38	94	188
Col_d	1	11,692,099	1	1	1	1

Link to FindMiRNA for this sequence