Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: CATGTGCCCATCTTCACCATC
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	5	w	287,716	Phasing window	AT5G01747	w	287,586	287,734	MIR164/MIR164B; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	5	w	287,716	Phasing window	ath-MIR164b	w	287,584	287,736	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	0	4,877,516	0	0	0	0
C0F2	1	2,789,465	1	1	2	4
d1F1	0	3,574,742	0	0	0	0
d1F2	0	3,705,660	0	0	0	0
d234F1	0	1,417,116	0	0	0	0
d234F2	5	3,822,319	1	3	7	13
r2F1	3	2,195,923	1	3	7	14
r2F2	3	2,233,522	1	3	7	13
r2FSb	11	5,728,276	2	4	10	19
r2FNaSb	6	5,311,047	1	2	6	11
r2FNa1	6	1,834,656	3	7	16	33
r2FNa2	10	6,081,068	2	3	8	16
r2FL	1	1,145,942	1	2	4	9
r2FD	14	4,928,142	3	6	14	28
C0FCSb	0	9,399,678	0	0	0	0
C0FSb	0	9,361,008	0	0	0	0
r2SC1	1	3,743,342	1	1	1	3
r2SH	1	2,165,395	1	1	2	5
r2SNa1	0	2,082,930	0	0	0	0
r2SC3	11	3,997,922	3	6	14	28
r2SNa2	0	4,617,795	0	0	0	0
r2SSb	19	3,278,680	6	12	29	58
r2SNaSb	3	3,087,212	1	2	5	10
r2SC2	1	476,105	2	4	11	21
r2SP	0	976,646	0	0	0	0
C0RC1	3	1,249,181	2	5	12	24
C0RNi	7	1,211,490	6	12	29	58
AtCM	5	14,488,208	1	1	2	3
AT_Leaf	11	8,047,907	1	3	7	14
At_miR1507OX_1	8	1,478,373	5	11	27	54
At_miR1507OX_2	19	1,638,916	12	23	58	116
At_miR2109OX_1	17	1,760,055	10	19	48	97
At_miR2109OX_2	8	2,446,954	3	7	16	33
At_miR2118aOX_1	10	1,212,493	8	16	41	82
At_miR2118aOX_2	16	1,258,140	13	25	64	127
At_miR2118bOX_1	11	2,023,619	5	11	27	54
At_miR2118bOX_2	19	1,733,586	11	22	55	110
At_miR2118cOX_1	15	1,995,522	8	15	38	75
At_miR2118cOX_2	8	2,496,180	3	6	16	32
At_miROX_control	13	1,838,508	7	14	35	71
At_miROX_ck_2	13	1,804,409	7	14	36	72
hen1-8	35	5,456,831	6	13	32	64
hen1-8 ntp2-1	43	6,244,400	7	14	34	69
hen1-8 urt1-1	33	6,081,292	5	11	27	54
hen1-8 ntp4-1	39	4,626,878	8	17	42	84
hen1-8 ntp5-1	77	5,676,073	14	27	68	136
hen1-8 ntp6-1	512	4,328,718	118	237	591	1,183
hen1-8 ntp7-1	42	4,409,080	10	19	48	95
hen1-8 ntp8-1	78	8,736,008	9	18	45	89
hen1-8 ntp10-1	36	6,387,459	6	11	28	56
hen1-8 r2	19	2,874,203	7	13	33	66
hen1-8 heso1-1	33	6,015,054	5	11	27	55
hen1-8 mee44	34	3,435,030	10	20	49	99
Wt_d	16	7,517,450	2	4	11	21
Col_d	129	11,692,099	11	22	55	110

Link to FindMiRNA for this sequence