Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: CATTCAAGGACTTCTATTCAG
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11w22,577,426Phasing windowAT1G61226w22,577,41722,577,691MIR846a; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21w22,577,426Phasing windowath-MIR846w22,577,37522,577,733miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F203,822,319  0000
r2F132,195,923  13714
r2F2122,233,522  5112754
r2FSb275,728,276  592447
r2FNaSb285,311,047  5112653
r2FNa191,834,656  5102549
r2FNa2396,081,068  6133264
r2FL21,145,942  23917
r2FD194,928,142  481939
C0FCSb19,399,678  1111
C0FSb19,361,008  1111
r2SC1153,743,342  482040
r2SH112,165,395  5102551
r2SNa1152,082,930  7143672
r2SC3203,997,922  5102550
r2SNa2244,617,795  5102652
r2SSb263,278,680  8164079
r2SNaSb173,087,212  6112855
r2SC238476,105  80160399798
r2SP51976,646  52104261522
C0RC1961,249,181  77154384769
C0RNi1261,211,490  1042085201,040
AtCM014,488,208  0000
AT_Leaf208,047,907  251225
At_miR1507OX_161,478,373  482041
At_miR1507OX_211,638,916  1136
At_miR2109OX_131,760,055  23917
At_miR2109OX_272,446,954  361429
At_miR2118aOX_121,212,493  23816
At_miR2118aOX_211,258,140  1248
At_miR2118bOX_162,023,619  361530
At_miR2118bOX_231,733,586  23917
At_miR2118cOX_171,995,522  471835
At_miR2118cOX_252,496,180  241020
At_miROX_control91,838,508  5102449
At_miROX_ck_221,804,409  12611
hen1-845,456,831  1147
hen1-8 ntp2-116,244,400  1112
hen1-8 urt1-156,081,292  1248
hen1-8 ntp4-134,626,878  1136
hen1-8 ntp5-155,676,073  1249
hen1-8 ntp6-1184,328,718  482142
hen1-8 ntp7-114,409,080  1112
hen1-8 ntp8-128,736,008  1112
hen1-8 ntp10-126,387,459  1123
hen1-8 r202,874,203  0000
hen1-8 heso1-116,015,054  1112
hen1-8 mee4413,435,030  1113
Wt_d77,517,450  1259
Col_d811,692,099  1137


Link to FindMiRNA for this sequence