Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: CCCGCCTTGCATCAACTGAAT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	4	w	10,578,737	Phasing window	AT4G19395	w	10,578,652	10,578,755	MIR168/MIR168A; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	4	w	10,578,737	Phasing window	ath-MIR168a	w	10,578,635	10,578,772	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	104	4,877,516	21	43	107	213
C0F2	49	2,789,465	18	35	88	176
d1F1	81	3,574,742	23	45	113	227
d1F2	82	3,705,660	22	44	111	221
d234F1	224	1,417,116	158	316	790	1,581
d234F2	786	3,822,319	206	411	1,028	2,056
r2F1	318	2,195,923	145	290	724	1,448
r2F2	271	2,233,522	121	243	607	1,213
r2FSb	991	5,728,276	173	346	865	1,730
r2FNaSb	935	5,311,047	176	352	880	1,760
r2FNa1	400	1,834,656	218	436	1,090	2,180
r2FNa2	632	6,081,068	104	208	520	1,039
r2FL	128	1,145,942	112	223	558	1,117
r2FD	680	4,928,142	138	276	690	1,380
C0FCSb	7	9,399,678	1	1	4	7
C0FSb	46	9,361,008	5	10	25	49
r2SC1	506	3,743,342	135	270	676	1,352
r2SH	84	2,165,395	39	78	194	388
r2SNa1	299	2,082,930	144	287	718	1,435
r2SC3	238	3,997,922	60	119	298	595
r2SNa2	829	4,617,795	180	359	898	1,795
r2SSb	1,060	3,278,680	323	647	1,617	3,233
r2SNaSb	913	3,087,212	296	591	1,479	2,957
r2SC2	79	476,105	166	332	830	1,659
r2SP	99	976,646	101	203	507	1,014
C0RC1	47	1,249,181	38	75	188	376
C0RNi	178	1,211,490	147	294	735	1,469
AtCM	90	14,488,208	6	12	31	62
AT_Leaf	924	8,047,907	115	230	574	1,148
At_miR1507OX_1	221	1,478,373	149	299	747	1,495
At_miR1507OX_2	222	1,638,916	135	271	677	1,355
At_miR2109OX_1	281	1,760,055	160	319	798	1,597
At_miR2109OX_2	531	2,446,954	217	434	1,085	2,170
At_miR2118aOX_1	133	1,212,493	110	219	548	1,097
At_miR2118aOX_2	381	1,258,140	303	606	1,514	3,028
At_miR2118bOX_1	163	2,023,619	81	161	403	805
At_miR2118bOX_2	119	1,733,586	69	137	343	686
At_miR2118cOX_1	789	1,995,522	395	791	1,977	3,954
At_miR2118cOX_2	185	2,496,180	74	148	371	741
At_miROX_control	92	1,838,508	50	100	250	500
At_miROX_ck_2	114	1,804,409	63	126	316	632
hen1-8	122	5,456,831	22	45	112	224
hen1-8 ntp2-1	101	6,244,400	16	32	81	162
hen1-8 urt1-1	262	6,081,292	43	86	215	431
hen1-8 ntp4-1	137	4,626,878	30	59	148	296
hen1-8 ntp5-1	321	5,676,073	57	113	283	566
hen1-8 ntp6-1	3,433	4,328,718	793	1,586	3,965	7,931
hen1-8 ntp7-1	82	4,409,080	19	37	93	186
hen1-8 ntp8-1	227	8,736,008	26	52	130	260
hen1-8 ntp10-1	164	6,387,459	26	51	128	257
hen1-8 r2	74	2,874,203	26	51	129	257
hen1-8 heso1-1	98	6,015,054	16	33	81	163
hen1-8 mee44	152	3,435,030	44	88	221	442
Wt_d	226	7,517,450	30	60	150	301
Col_d	2,235	11,692,099	191	382	956	1,912

Link to FindMiRNA for this sequence