Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: CCCGTCTTGTATCAACTGAAT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15c18,358,823Phasing windowAT5G45307c18,358,80518,358,893MIR168/MIR168B; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
25c18,358,823Phasing windowath-MIR168bc18,358,78818,358,911miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F124,877,516  1124
C0F242,789,465  13714
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F213,822,319  1113
r2F102,195,923  0000
r2F212,233,522  1124
r2FSb15,728,276  1112
r2FNaSb15,311,047  1112
r2FNa101,834,656  0000
r2FNa206,081,068  0000
r2FL01,145,942  0000
r2FD04,928,142  0000
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC103,743,342  0000
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC343,997,922  12510
r2SNa204,617,795  0000
r2SSb63,278,680  24918
r2SNaSb13,087,212  1123
r2SC21476,105  241121
r2SP2976,646  241020
C0RC111,249,181  1248
C0RNi11,211,490  1248
AtCM014,488,208  0000
AT_Leaf1438,047,907  183689178
At_miR1507OX_1151,478,373  102051101
At_miR1507OX_2141,638,916  9174385
At_miR2109OX_1131,760,055  7153774
At_miR2109OX_2252,446,954  102051102
At_miR2118aOX_161,212,493  5102549
At_miR2118aOX_2141,258,140  112256111
At_miR2118bOX_192,023,619  492244
At_miR2118bOX_2121,733,586  7143569
At_miR2118cOX_1491,995,522  2549123246
At_miR2118cOX_292,496,180  471836
At_miROX_control31,838,508  23816
At_miROX_ck_241,804,409  241122
hen1-8185,456,831  371633
hen1-8 ntp2-1256,244,400  482040
hen1-8 urt1-1466,081,292  8153876
hen1-8 ntp4-1134,626,878  361428
hen1-8 ntp5-1365,676,073  6133263
hen1-8 ntp6-11744,328,718  4080201402
hen1-8 ntp7-1154,409,080  371734
hen1-8 ntp8-1338,736,008  481938
hen1-8 ntp10-1266,387,459  482041
hen1-8 r2212,874,203  7153773
hen1-8 heso1-1236,015,054  481938
hen1-8 mee44123,435,030  371735
Wt_d07,517,450  0000
Col_d3711,692,099  361632


Link to FindMiRNA for this sequence