Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: CCGTATCTTGGCCTTGTCATT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11c16,766,305Phasing windowAT1G44100c16,764,40516,767,685amino acid permease 5

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21c16,766,305Phasing windowath-MIR5024c16,766,25916,766,438miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F104,877,516  0000
C0F202,789,465  0000
d1F103,574,742  0000
d1F203,705,660  0000
d234F101,417,116  0000
d234F203,822,319  0000
r2F102,195,923  0000
r2F212,233,522  1124
r2FSb15,728,276  1112
r2FNaSb35,311,047  1136
r2FNa101,834,656  0000
r2FNa226,081,068  1123
r2FL01,145,942  0000
r2FD04,928,142  0000
C0FCSb09,399,678  0000
C0FSb09,361,008  0000
r2SC103,743,342  0000
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC323,997,922  1135
r2SNa224,617,795  1124
r2SSb03,278,680  0000
r2SNaSb13,087,212  1123
r2SC22476,105  482142
r2SP1976,646  12510
C0RC131,249,181  251224
C0RNi11,211,490  1248
AtCM014,488,208  0000
AT_Leaf78,047,907  1249
At_miR1507OX_121,478,373  13714
At_miR1507OX_201,638,916  0000
At_miR2109OX_101,760,055  0000
At_miR2109OX_222,446,954  1248
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_211,258,140  1248
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_211,733,586  1136
At_miR2118cOX_111,995,522  1135
At_miR2118cOX_212,496,180  1124
At_miROX_control31,838,508  23816
At_miROX_ck_211,804,409  1136
hen1-805,456,831  0000
hen1-8 ntp2-106,244,400  0000
hen1-8 urt1-116,081,292  1112
hen1-8 ntp4-114,626,878  1112
hen1-8 ntp5-115,676,073  1112
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-104,409,080  0000
hen1-8 ntp8-108,736,008  0000
hen1-8 ntp10-106,387,459  0000
hen1-8 r202,874,203  0000
hen1-8 heso1-106,015,054  0000
hen1-8 mee4403,435,030  0000
Wt_d07,517,450  0000
Col_d411,692,099  1123


Link to FindMiRNA for this sequence