Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: CGATGAAGGTCTTTGGAACGGTA
Length: 23 nucleotides
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15c16,409,826Phasing windowLink to IGR (1,420 bp)Small region at sequence (3 kb)




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F1244,877,516  5102549
C0F2302,789,465  112254108
d1F1163,574,742  492245
d1F2193,705,660  5102651
d234F111,417,116  1147
d234F213,822,319  1113
r2F102,195,923  0000
r2F202,233,522  0000
r2FSb05,728,276  0000
r2FNaSb05,311,047  0000
r2FNa101,834,656  0000
r2FNa206,081,068  0000
r2FL01,145,942  0000
r2FD04,928,142  0000
C0FCSb909,399,678  10194896
C0FSb789,361,008  8174283
r2SC103,743,342  0000
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC303,997,922  0000
r2SNa204,617,795  0000
r2SSb03,278,680  0000
r2SNaSb03,087,212  0000
r2SC20476,105  0000
r2SP0976,646  0000
C0RC111,249,181  1248
C0RNi91,211,490  7153774
AtCM1514,488,208  12510
AT_Leaf228,047,907  351427
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_111,760,055  1136
At_miR2109OX_212,446,954  1124
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_112,023,619  1125
At_miR2118bOX_211,733,586  1136
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_202,496,180  0000
At_miROX_control01,838,508  0000
At_miROX_ck_201,804,409  0000
hen1-805,456,831  0000
hen1-8 ntp2-186,244,400  13613
hen1-8 urt1-146,081,292  1137
hen1-8 ntp4-124,626,878  1124
hen1-8 ntp5-125,676,073  1124
hen1-8 ntp6-104,328,718  0000
hen1-8 ntp7-144,409,080  1259
hen1-8 ntp8-148,736,008  1125
hen1-8 ntp10-106,387,459  0000
hen1-8 r212,874,203  1123
hen1-8 heso1-106,015,054  0000
hen1-8 mee4423,435,030  1136
Wt_d77,517,450  1259
Col_d011,692,099  0000


Link to FindMiRNA for this sequence