Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: CGCAAATGCGGATATCAATGT
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
11c234,146Phasing windowAT1G01650c232,841237,817SIGNAL PEPTIDE PEPTIDASE-LIKE 4

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
21c234,146Phasing windowath-MIR2112c234,006234,159miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F164,877,516  12612
C0F202,789,465  0000
d1F103,574,742  0000
d1F213,705,660  1113
d234F121,417,116  13714
d234F253,822,319  13713
r2F1162,195,923  7153673
r2F272,233,522  361631
r2FSb215,728,276  471837
r2FNaSb235,311,047  492243
r2FNa1101,834,656  5112755
r2FNa2416,081,068  7133467
r2FL21,145,942  23917
r2FD134,928,142  351326
C0FCSb09,399,678  0000
C0FSb79,361,008  1147
r2SC143,743,342  12511
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC313,997,922  1113
r2SNa244,617,795  1249
r2SSb33,278,680  1259
r2SNaSb43,087,212  13613
r2SC20476,105  0000
r2SP2976,646  241020
C0RC101,249,181  0000
C0RNi01,211,490  0000
AtCM114,488,208  1111
AT_Leaf468,047,907  6112957
At_miR1507OX_111,478,373  1137
At_miR1507OX_221,638,916  12612
At_miR2109OX_111,760,055  1136
At_miR2109OX_222,446,954  1248
At_miR2118aOX_101,212,493  0000
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_112,023,619  1125
At_miR2118bOX_211,733,586  1136
At_miR2118cOX_101,995,522  0000
At_miR2118cOX_212,496,180  1124
At_miROX_control01,838,508  0000
At_miROX_ck_231,804,409  23817
hen1-8165,456,831  361529
hen1-8 ntp2-1176,244,400  351427
hen1-8 urt1-166,081,292  12510
hen1-8 ntp4-194,626,878  241019
hen1-8 ntp5-1305,676,073  5112653
hen1-8 ntp6-1724,328,718  173383166
hen1-8 ntp7-174,409,080  23816
hen1-8 ntp8-198,736,008  12510
hen1-8 ntp10-166,387,459  1259
hen1-8 r242,874,203  13714
hen1-8 heso1-1106,015,054  23817
hen1-8 mee4473,435,030  241020
Wt_d137,517,450  23917
Col_d311,692,099  1113


Link to FindMiRNA for this sequence