Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

Sequence: CGCTATCCATCCTGAGTTCC
Length: 20 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
15w23,637,034Phasing windowAT5G58465w23,636,94723,637,066MIR390B; miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#ChrStrandCoordinatePhasing AnalysisGeneGene strandGene startGene stopGene function
25w23,637,034Phasing windowath-MIR390bw23,636,94723,637,066miRNA




Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data Normalization Denominator
Data typeRawTotal  1M2M5M10M
C0F114,877,516  1112
C0F222,789,465  1147
d1F103,574,742  0000
d1F233,705,660  1248
d234F121,417,116  13714
d234F2173,822,319  492244
r2F162,195,923  351427
r2F2132,233,522  6122958
r2FSb315,728,276  5112754
r2FNaSb325,311,047  6123060
r2FNa141,834,656  241122
r2FNa2296,081,068  5102448
r2FL21,145,942  23917
r2FD154,928,142  361530
C0FCSb09,399,678  0000
C0FSb19,361,008  1111
r2SC113,743,342  1113
r2SH02,165,395  0000
r2SNa102,082,930  0000
r2SC353,997,922  13613
r2SNa284,617,795  23917
r2SSb263,278,680  8164079
r2SNaSb43,087,212  13613
r2SC28476,105  173484168
r2SP0976,646  0000
C0RC121,249,181  23816
C0RNi01,211,490  0000
AtCM1114,488,208  1248
AT_Leaf168,047,907  241020
At_miR1507OX_101,478,373  0000
At_miR1507OX_201,638,916  0000
At_miR2109OX_111,760,055  1136
At_miR2109OX_212,446,954  1124
At_miR2118aOX_111,212,493  1248
At_miR2118aOX_201,258,140  0000
At_miR2118bOX_102,023,619  0000
At_miR2118bOX_231,733,586  23917
At_miR2118cOX_111,995,522  1135
At_miR2118cOX_212,496,180  1124
At_miROX_control01,838,508  0000
At_miROX_ck_221,804,409  12611
hen1-8315,456,831  6112857
hen1-8 ntp2-1296,244,400  592346
hen1-8 urt1-1396,081,292  6133264
hen1-8 ntp4-1244,626,878  5102652
hen1-8 ntp5-1695,676,073  122461122
hen1-8 ntp6-13484,328,718  80161402804
hen1-8 ntp7-1444,409,080  102050100
hen1-8 ntp8-1628,736,008  7143571
hen1-8 ntp10-1496,387,459  8153877
hen1-8 r2112,874,203  481938
hen1-8 heso1-156,015,054  1248
hen1-8 mee44243,435,030  7143570
Wt_d307,517,450  482040
Col_d8011,692,099  7143468


Link to FindMiRNA for this sequence