Arabidopsis small RNA Signature Analysis

The basic information for the sequence you selected is listed below. In the second table, all occurrences of this sequence are listed regardless of the genomic location you selected.

New Search

Sequence: CGCTATCCATCCTGAGTTTCA
Length: 21 nucleotides
This small RNA sequence matches a miRNA
Number of hits: 1

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
1	2	w	16,062,023	Phasing window	AT2G38325	w	16,061,954	16,062,060	miRNA

Other perfect matches found in genome in addition to that listed above.
This sequence is listed at the same location more than once (in table below), because there are multiple associated genes at that locus.

#	Chr	Strand	Coordinate	Phasing Analysis	Gene	Gene strand	Gene start	Gene stop	Gene function
2	2	w	16,062,023	Phasing window	ath-MIR390a	w	16,061,954	16,062,060	miRNA

Expression Data for This Signature

SBS data are shown in table below. The raw abundance and totals are listed to the left (totals reflect only genome-matched signatures), with several columns to the right indicating the normalized values for different denominators. The normalization denominator may vary among libraries, because the total number of genome-matched reads varies substantially (depending on the depth of sequencing). Black text is used to identify the most appropriate normalized value.

Raw Data			Normalization Denominator
Data type	Raw	Total	1M	2M	5M	10M
C0F1	48	4,877,516	10	20	49	98
C0F2	24	2,789,465	9	17	43	86
d1F1	1	3,574,742	1	1	1	3
d1F2	7	3,705,660	2	4	9	19
d234F1	39	1,417,116	28	55	138	275
d234F2	457	3,822,319	120	239	598	1,196
r2F1	118	2,195,923	54	107	269	537
r2F2	139	2,233,522	62	124	311	622
r2FSb	721	5,728,276	126	252	629	1,259
r2FNaSb	896	5,311,047	169	337	844	1,687
r2FNa1	83	1,834,656	45	90	226	452
r2FNa2	1,223	6,081,068	201	402	1,006	2,011
r2FL	66	1,145,942	58	115	288	576
r2FD	403	4,928,142	82	164	409	818
C0FCSb	3	9,399,678	1	1	2	3
C0FSb	26	9,361,008	3	6	14	28
r2SC1	12	3,743,342	3	6	16	32
r2SH	14	2,165,395	6	13	32	65
r2SNa1	0	2,082,930	0	0	0	0
r2SC3	36	3,997,922	9	18	45	90
r2SNa2	39	4,617,795	8	17	42	84
r2SSb	259	3,278,680	79	158	395	790
r2SNaSb	23	3,087,212	7	15	37	75
r2SC2	86	476,105	181	361	903	1,806
r2SP	29	976,646	30	59	148	297
C0RC1	106	1,249,181	85	170	424	849
C0RNi	61	1,211,490	50	101	252	504
AtCM	63	14,488,208	4	9	22	43
AT_Leaf	644	8,047,907	80	160	400	800
At_miR1507OX_1	20	1,478,373	14	27	68	135
At_miR1507OX_2	21	1,638,916	13	26	64	128
At_miR2109OX_1	20	1,760,055	11	23	57	114
At_miR2109OX_2	60	2,446,954	25	49	123	245
At_miR2118aOX_1	11	1,212,493	9	18	45	91
At_miR2118aOX_2	27	1,258,140	21	43	107	215
At_miR2118bOX_1	19	2,023,619	9	19	47	94
At_miR2118bOX_2	14	1,733,586	8	16	40	81
At_miR2118cOX_1	56	1,995,522	28	56	140	281
At_miR2118cOX_2	23	2,496,180	9	18	46	92
At_miROX_control	9	1,838,508	5	10	24	49
At_miROX_ck_2	20	1,804,409	11	22	55	111
hen1-8	21	5,456,831	4	8	19	38
hen1-8 ntp2-1	14	6,244,400	2	4	11	22
hen1-8 urt1-1	19	6,081,292	3	6	16	31
hen1-8 ntp4-1	15	4,626,878	3	6	16	32
hen1-8 ntp5-1	45	5,676,073	8	16	40	79
hen1-8 ntp6-1	531	4,328,718	123	245	613	1,227
hen1-8 ntp7-1	23	4,409,080	5	10	26	52
hen1-8 ntp8-1	26	8,736,008	3	6	15	30
hen1-8 ntp10-1	9	6,387,459	1	3	7	14
hen1-8 r2	12	2,874,203	4	8	21	42
hen1-8 heso1-1	12	6,015,054	2	4	10	20
hen1-8 mee44	16	3,435,030	5	9	23	47
Wt_d	572	7,517,450	76	152	380	761
Col_d	769	11,692,099	66	132	329	658

Link to FindMiRNA for this sequence